ID: 968076197

View in Genome Browser
Species Human (GRCh38)
Location 3:195817129-195817151
Sequence GCACCTGCATAAGGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076197_968076200 -6 Left 968076197 3:195817129-195817151 CCTCCTTCTCCTTATGCAGGTGC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076197_968076206 13 Left 968076197 3:195817129-195817151 CCTCCTTCTCCTTATGCAGGTGC No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076197 Original CRISPR GCACCTGCATAAGGAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr