ID: 968076200

View in Genome Browser
Species Human (GRCh38)
Location 3:195817146-195817168
Sequence AGGTGCCACATCCTCCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076191_968076200 8 Left 968076191 3:195817115-195817137 CCTGCCCGGCCCGGCCTCCTTCT No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076198_968076200 -9 Left 968076198 3:195817132-195817154 CCTTCTCCTTATGCAGGTGCCAC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076186_968076200 24 Left 968076186 3:195817099-195817121 CCAGGTGCCACATCCTCCTGCCC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076193_968076200 3 Left 968076193 3:195817120-195817142 CCGGCCCGGCCTCCTTCTCCTTA No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076194_968076200 -1 Left 968076194 3:195817124-195817146 CCCGGCCTCCTTCTCCTTATGCA No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076197_968076200 -6 Left 968076197 3:195817129-195817151 CCTCCTTCTCCTTATGCAGGTGC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076190_968076200 11 Left 968076190 3:195817112-195817134 CCTCCTGCCCGGCCCGGCCTCCT No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076185_968076200 29 Left 968076185 3:195817094-195817116 CCTTACCAGGTGCCACATCCTCC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076192_968076200 4 Left 968076192 3:195817119-195817141 CCCGGCCCGGCCTCCTTCTCCTT No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076188_968076200 17 Left 968076188 3:195817106-195817128 CCACATCCTCCTGCCCGGCCCGG No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076195_968076200 -2 Left 968076195 3:195817125-195817147 CCGGCCTCCTTCTCCTTATGCAG No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076200 Original CRISPR AGGTGCCACATCCTCCTGCC CGG Intergenic
No off target data available for this crispr