ID: 968076205

View in Genome Browser
Species Human (GRCh38)
Location 3:195817165-195817187
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076205_968076219 21 Left 968076205 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076219 3:195817209-195817231 CCGGCCTCCTTCTCCTTACCAGG No data
968076205_968076212 2 Left 968076205 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076212 3:195817190-195817212 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076205 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr