ID: 968076206

View in Genome Browser
Species Human (GRCh38)
Location 3:195817165-195817187
Sequence CCGGCCTCCTTCTCCTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076198_968076206 10 Left 968076198 3:195817132-195817154 CCTTCTCCTTATGCAGGTGCCAC No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076190_968076206 30 Left 968076190 3:195817112-195817134 CCTCCTGCCCGGCCCGGCCTCCT No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076197_968076206 13 Left 968076197 3:195817129-195817151 CCTCCTTCTCCTTATGCAGGTGC No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076193_968076206 22 Left 968076193 3:195817120-195817142 CCGGCCCGGCCTCCTTCTCCTTA No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076201_968076206 -9 Left 968076201 3:195817151-195817173 CCACATCCTCCTGCCCGGCCTCC No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076191_968076206 27 Left 968076191 3:195817115-195817137 CCTGCCCGGCCCGGCCTCCTTCT No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076199_968076206 4 Left 968076199 3:195817138-195817160 CCTTATGCAGGTGCCACATCCTC No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076194_968076206 18 Left 968076194 3:195817124-195817146 CCCGGCCTCCTTCTCCTTATGCA No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076195_968076206 17 Left 968076195 3:195817125-195817147 CCGGCCTCCTTCTCCTTATGCAG No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data
968076192_968076206 23 Left 968076192 3:195817119-195817141 CCCGGCCCGGCCTCCTTCTCCTT No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076206 Original CRISPR CCGGCCTCCTTCTCCTTACC AGG Intergenic
No off target data available for this crispr