ID: 968076218

View in Genome Browser
Species Human (GRCh38)
Location 3:195817209-195817231
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076218_968076225 2 Left 968076218 3:195817209-195817231 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076225 3:195817234-195817256 CCACATCCTCCTGCCCAGCCCGG No data
968076218_968076232 22 Left 968076218 3:195817209-195817231 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076232 3:195817254-195817276 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076218 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr