ID: 968076231

View in Genome Browser
Species Human (GRCh38)
Location 3:195817253-195817275
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076231_968076238 3 Left 968076231 3:195817253-195817275 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968076238 3:195817279-195817301 CCACATCCTCCTGCCCGGCCTGG No data
968076231_968076236 -2 Left 968076231 3:195817253-195817275 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968076236 3:195817274-195817296 AGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076231 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr