ID: 968076255

View in Genome Browser
Species Human (GRCh38)
Location 3:195817343-195817365
Sequence CCTTGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076255_968076268 21 Left 968076255 3:195817343-195817365 CCGGCCTCCTTCTCCTTACAAGG No data
Right 968076268 3:195817387-195817409 CCGGCCTCCTTCTCCTTACCAGG No data
968076255_968076261 2 Left 968076255 3:195817343-195817365 CCGGCCTCCTTCTCCTTACAAGG No data
Right 968076261 3:195817368-195817390 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076255 Original CRISPR CCTTGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr