ID: 968076267

View in Genome Browser
Species Human (GRCh38)
Location 3:195817387-195817409
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076267_968076281 21 Left 968076267 3:195817387-195817409 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076281 3:195817431-195817453 CCAGCCTCCTTCTTCTTACCAGG No data
968076267_968076273 -3 Left 968076267 3:195817387-195817409 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076273 3:195817407-195817429 AGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076267 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr