ID: 968076293

View in Genome Browser
Species Human (GRCh38)
Location 3:195817475-195817497
Sequence CTGTGTAAGGAGAACGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076293_968076306 22 Left 968076293 3:195817475-195817497 CCGGCCTCGTTCTCCTTACACAG No data
Right 968076306 3:195817520-195817542 CCGGCCTCCTTCTCCTTACCAGG No data
968076293_968076299 3 Left 968076293 3:195817475-195817497 CCGGCCTCGTTCTCCTTACACAG No data
Right 968076299 3:195817501-195817523 CCACATCCTCCTGCCCGGCCCGG No data
968076293_968076297 -2 Left 968076293 3:195817475-195817497 CCGGCCTCGTTCTCCTTACACAG No data
Right 968076297 3:195817496-195817518 AGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076293 Original CRISPR CTGTGTAAGGAGAACGAGGC CGG (reversed) Intergenic
No off target data available for this crispr