ID: 968076305

View in Genome Browser
Species Human (GRCh38)
Location 3:195817520-195817542
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076305_968076319 22 Left 968076305 3:195817520-195817542 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076319 3:195817565-195817587 CGGCCTCCTTCTCCTTAAGCAGG No data
968076305_968076312 2 Left 968076305 3:195817520-195817542 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076312 3:195817545-195817567 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076305 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr