ID: 968076847

View in Genome Browser
Species Human (GRCh38)
Location 3:195820660-195820682
Sequence CAGCCCGGGAATGCGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076847_968076857 20 Left 968076847 3:195820660-195820682 CCATTCTCCGCATTCCCGGGCTG No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076847 Original CRISPR CAGCCCGGGAATGCGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr