ID: 968076850

View in Genome Browser
Species Human (GRCh38)
Location 3:195820674-195820696
Sequence AGGGACACGGCTGCCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076850_968076857 6 Left 968076850 3:195820674-195820696 CCCGGGCTGGCAGCCGTGTCCCT No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076850 Original CRISPR AGGGACACGGCTGCCAGCCC GGG (reversed) Intergenic
No off target data available for this crispr