ID: 968076852

View in Genome Browser
Species Human (GRCh38)
Location 3:195820687-195820709
Sequence AGGCAGAGGCTGGAGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076852_968076857 -7 Left 968076852 3:195820687-195820709 CCGTGTCCCTCCAGCCTCTGCCT No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076852 Original CRISPR AGGCAGAGGCTGGAGGGACA CGG (reversed) Intergenic
No off target data available for this crispr