ID: 968076857

View in Genome Browser
Species Human (GRCh38)
Location 3:195820703-195820725
Sequence TCTGCCTCCATCGTGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076850_968076857 6 Left 968076850 3:195820674-195820696 CCCGGGCTGGCAGCCGTGTCCCT No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data
968076852_968076857 -7 Left 968076852 3:195820687-195820709 CCGTGTCCCTCCAGCCTCTGCCT No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data
968076849_968076857 13 Left 968076849 3:195820667-195820689 CCGCATTCCCGGGCTGGCAGCCG No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data
968076851_968076857 5 Left 968076851 3:195820675-195820697 CCGGGCTGGCAGCCGTGTCCCTC No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data
968076847_968076857 20 Left 968076847 3:195820660-195820682 CCATTCTCCGCATTCCCGGGCTG No data
Right 968076857 3:195820703-195820725 TCTGCCTCCATCGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076857 Original CRISPR TCTGCCTCCATCGTGTTGTG TGG Intergenic
No off target data available for this crispr