ID: 968076963

View in Genome Browser
Species Human (GRCh38)
Location 3:195821296-195821318
Sequence AAGGTTGACCTGCTATTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076954_968076963 29 Left 968076954 3:195821244-195821266 CCCAGGCAGCAGTGGCCACACCT No data
Right 968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG No data
968076955_968076963 28 Left 968076955 3:195821245-195821267 CCAGGCAGCAGTGGCCACACCTG No data
Right 968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG No data
968076958_968076963 9 Left 968076958 3:195821264-195821286 CCTGCCTCAGTGGTTTCAGCCCT No data
Right 968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG No data
968076961_968076963 -10 Left 968076961 3:195821283-195821305 CCCTGCTCTCTCAAAGGTTGACC No data
Right 968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG No data
968076959_968076963 5 Left 968076959 3:195821268-195821290 CCTCAGTGGTTTCAGCCCTGCTC No data
Right 968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG No data
968076957_968076963 14 Left 968076957 3:195821259-195821281 CCACACCTGCCTCAGTGGTTTCA No data
Right 968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076963 Original CRISPR AAGGTTGACCTGCTATTGAC TGG Intergenic
No off target data available for this crispr