ID: 968077407

View in Genome Browser
Species Human (GRCh38)
Location 3:195824117-195824139
Sequence AAGCAGGGCCTGGGTGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968077398_968077407 12 Left 968077398 3:195824082-195824104 CCCAGGAGGGCCACAGACAAGTG No data
Right 968077407 3:195824117-195824139 AAGCAGGGCCTGGGTGGCGCTGG No data
968077397_968077407 18 Left 968077397 3:195824076-195824098 CCTCTGCCCAGGAGGGCCACAGA No data
Right 968077407 3:195824117-195824139 AAGCAGGGCCTGGGTGGCGCTGG No data
968077401_968077407 2 Left 968077401 3:195824092-195824114 CCACAGACAAGTGGAGAAAGCAG No data
Right 968077407 3:195824117-195824139 AAGCAGGGCCTGGGTGGCGCTGG No data
968077399_968077407 11 Left 968077399 3:195824083-195824105 CCAGGAGGGCCACAGACAAGTGG No data
Right 968077407 3:195824117-195824139 AAGCAGGGCCTGGGTGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968077407 Original CRISPR AAGCAGGGCCTGGGTGGCGC TGG Intergenic