ID: 968079905

View in Genome Browser
Species Human (GRCh38)
Location 3:195838624-195838646
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968079898_968079905 17 Left 968079898 3:195838584-195838606 CCTGTAATCCCAGCTACTCGGGA 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
Right 968079905 3:195838624-195838646 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
968079902_968079905 8 Left 968079902 3:195838593-195838615 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 968079905 3:195838624-195838646 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
968079900_968079905 9 Left 968079900 3:195838592-195838614 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 968079905 3:195838624-195838646 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968079905 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intergenic
Too many off-targets to display for this crispr