ID: 968080567

View in Genome Browser
Species Human (GRCh38)
Location 3:195843592-195843614
Sequence CGGGCTGCACCCGAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968080561_968080567 -5 Left 968080561 3:195843574-195843596 CCACGTGCCCGGCGTCACCGGGC No data
Right 968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG No data
968080556_968080567 10 Left 968080556 3:195843559-195843581 CCCTGGCAAGCTCTTCCACGTGC No data
Right 968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG No data
968080557_968080567 9 Left 968080557 3:195843560-195843582 CCTGGCAAGCTCTTCCACGTGCC No data
Right 968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968080567 Original CRISPR CGGGCTGCACCCGAGCAGGG TGG Intergenic
No off target data available for this crispr