ID: 968082101

View in Genome Browser
Species Human (GRCh38)
Location 3:195853781-195853803
Sequence CTCAGGCGAATTTTCTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968082101_968082105 -4 Left 968082101 3:195853781-195853803 CCCAAATAGAAAATTCGCCTGAG No data
Right 968082105 3:195853800-195853822 TGAGAGGCACAAGATGAGAATGG No data
968082101_968082110 21 Left 968082101 3:195853781-195853803 CCCAAATAGAAAATTCGCCTGAG No data
Right 968082110 3:195853825-195853847 CACAGGCCATGGACCTCCACAGG No data
968082101_968082106 -3 Left 968082101 3:195853781-195853803 CCCAAATAGAAAATTCGCCTGAG No data
Right 968082106 3:195853801-195853823 GAGAGGCACAAGATGAGAATGGG No data
968082101_968082107 4 Left 968082101 3:195853781-195853803 CCCAAATAGAAAATTCGCCTGAG No data
Right 968082107 3:195853808-195853830 ACAAGATGAGAATGGGCCACAGG No data
968082101_968082108 10 Left 968082101 3:195853781-195853803 CCCAAATAGAAAATTCGCCTGAG No data
Right 968082108 3:195853814-195853836 TGAGAATGGGCCACAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968082101 Original CRISPR CTCAGGCGAATTTTCTATTT GGG (reversed) Intergenic