ID: 968082104

View in Genome Browser
Species Human (GRCh38)
Location 3:195853798-195853820
Sequence ATTCTCATCTTGTGCCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968082104_968082115 24 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082115 3:195853845-195853867 AGGCAGCCCCGAGGCCTCCTCGG No data
968082104_968082110 4 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082110 3:195853825-195853847 CACAGGCCATGGACCTCCACAGG No data
968082104_968082112 15 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082112 3:195853836-195853858 GACCTCCACAGGCAGCCCCGAGG No data
968082104_968082118 30 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082118 3:195853851-195853873 CCCCGAGGCCTCCTCGGGTTTGG No data
968082104_968082116 25 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082116 3:195853846-195853868 GGCAGCCCCGAGGCCTCCTCGGG No data
968082104_968082108 -7 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082108 3:195853814-195853836 TGAGAATGGGCCACAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968082104 Original CRISPR ATTCTCATCTTGTGCCTCTC AGG (reversed) Intergenic