ID: 968082110

View in Genome Browser
Species Human (GRCh38)
Location 3:195853825-195853847
Sequence CACAGGCCATGGACCTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968082104_968082110 4 Left 968082104 3:195853798-195853820 CCTGAGAGGCACAAGATGAGAAT No data
Right 968082110 3:195853825-195853847 CACAGGCCATGGACCTCCACAGG No data
968082101_968082110 21 Left 968082101 3:195853781-195853803 CCCAAATAGAAAATTCGCCTGAG No data
Right 968082110 3:195853825-195853847 CACAGGCCATGGACCTCCACAGG No data
968082102_968082110 20 Left 968082102 3:195853782-195853804 CCAAATAGAAAATTCGCCTGAGA No data
Right 968082110 3:195853825-195853847 CACAGGCCATGGACCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968082110 Original CRISPR CACAGGCCATGGACCTCCAC AGG Intergenic