ID: 968085127

View in Genome Browser
Species Human (GRCh38)
Location 3:195870747-195870769
Sequence TGGGCTGGCCACAGCATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 353}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968085125_968085127 -7 Left 968085125 3:195870731-195870753 CCTGGAGGAATGGGGCTGGGCTG 0: 1
1: 0
2: 2
3: 63
4: 528
Right 968085127 3:195870747-195870769 TGGGCTGGCCACAGCATGCCAGG 0: 1
1: 1
2: 3
3: 27
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968085127 Original CRISPR TGGGCTGGCCACAGCATGCC AGG Intronic
900613087 1:3552737-3552759 TGAGGAGGCCACAGCCTGCCAGG + Intronic
900641674 1:3690594-3690616 GGGGCAGGCCTCAGCTTGCCCGG - Intronic
901035394 1:6333297-6333319 TGGGCTGGGCAGGGCATCCCTGG - Intronic
901459468 1:9383119-9383141 GGGGCTGAGCACAGCATGCGTGG - Intergenic
901678010 1:10898161-10898183 TGAGCTGGCCCCAGTCTGCCTGG - Intergenic
902368742 1:15992855-15992877 TGGGCTGCCCAGTCCATGCCAGG - Intergenic
903305904 1:22413101-22413123 TGGGGTGGTCACAGCCTCCCTGG - Intergenic
903500869 1:23799668-23799690 TGAGCTGGCCTCAGCCTGCCTGG - Intronic
904040739 1:27583345-27583367 TGGGGGAGCCAGAGCATGCCAGG - Intronic
904168948 1:28577622-28577644 TGGCCTGGCTACATCATGGCAGG - Exonic
904252233 1:29233311-29233333 TGGGCTGGTCACTCCAGGCCAGG + Intergenic
904287661 1:29462459-29462481 TGGCCTGGCCACTGCATGCCAGG + Intergenic
904403815 1:30273574-30273596 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
905210985 1:36374071-36374093 TGTGCTGAGCACAGCAGGCCTGG + Intronic
906065781 1:42979291-42979313 TGTGATGGCTACAGCATGGCAGG + Intergenic
906528750 1:46511393-46511415 AGGACTGACCACAGCAGGCCTGG + Intronic
907045518 1:51297940-51297962 TGGGCAGGGCACAGCAGGGCAGG - Intronic
907164001 1:52393929-52393951 TGGGCTGGAGAAAGCAAGCCTGG - Intronic
907333433 1:53685909-53685931 GGGGCTGGCCACAGGCTGGCTGG - Intronic
907410247 1:54278682-54278704 TGGGCTGGCCACCCTAGGCCAGG + Intronic
907430558 1:54408829-54408851 AGGGCTGACCACAGAGTGCCTGG - Intronic
909370199 1:74874644-74874666 TAACCTGGCCTCAGCATGCCAGG + Intergenic
911899061 1:103477860-103477882 TGGTCTGGACTTAGCATGCCTGG - Intergenic
912557038 1:110523997-110524019 TGGGATGCCTACTGCATGCCAGG - Intergenic
914923619 1:151864842-151864864 TGGGCTGCCTACAGGAAGCCAGG - Intergenic
917908303 1:179612471-179612493 TGGGCTGGACACAGCATCTGAGG - Intronic
919178227 1:194047321-194047343 TGGCCTGGCCACATATTGCCAGG + Intergenic
919918452 1:202153667-202153689 TGGGCCGCCCACAGCATCTCTGG - Intronic
920004992 1:202826585-202826607 TGGGCTGATCTCAGCATCCCAGG - Exonic
920364373 1:205440347-205440369 TGGGCTGGCCACCTCAGGCCTGG + Intronic
921012892 1:211160906-211160928 TGGGCTGCCCACTGCATCTCTGG + Intergenic
921311529 1:213848984-213849006 TGGGCTGGCCACAACTTCACAGG + Intergenic
922349748 1:224725629-224725651 GGGGCTGGTGTCAGCATGCCTGG - Intronic
922732095 1:227954014-227954036 TGGGCTGGGCTCAGCCTCCCAGG - Intergenic
923170947 1:231416508-231416530 TGGGCTCGCACCACCATGCCTGG + Intronic
1064240321 10:13621517-13621539 TGGGCTAGCCACAGCTTCCCAGG + Intronic
1065677813 10:28197012-28197034 TTGGCTGCCCACAGCCTTCCTGG + Intronic
1067077138 10:43194421-43194443 TGGGAAGGCCACAGCAGGCCTGG + Intergenic
1069248979 10:66245043-66245065 TGAGCTGAGCACAGCCTGCCAGG - Intronic
1069566719 10:69468272-69468294 CTGGCTGCCCACAGCCTGCCTGG + Intronic
1070827854 10:79401608-79401630 AGGGATGCCCCCAGCATGCCAGG - Intronic
1071858937 10:89653189-89653211 TGGGCTGGACAAAGCATGTGAGG + Intergenic
1071882222 10:89911547-89911569 AGGCATGGCCACAGCATGCCTGG + Intergenic
1072486987 10:95865000-95865022 AGGGCTTGACACAGAATGCCAGG - Intronic
1073446646 10:103584970-103584992 TCGGCCGGCCGCAGCGTGCCGGG - Exonic
1074569959 10:114615314-114615336 TGGGCAGGGAAAAGCATGCCTGG - Intronic
1076406947 10:130218736-130218758 AGGGCAGGCCACAGCTTCCCAGG - Intergenic
1076604563 10:131681162-131681184 TGGGCTGGGCAGGGCATGCAGGG - Intergenic
1076609224 10:131710616-131710638 TTGGCTGGGCGCAGCATCCCTGG + Intergenic
1076821009 10:132939563-132939585 TGGGCTTGCCACAGCCACCCTGG - Intronic
1076852052 10:133098107-133098129 TGTGCTGGCCACAGCCTGGGCGG + Intronic
1077316425 11:1921293-1921315 CGGGCTGGGCACAGCAGGGCGGG + Intronic
1077430945 11:2515763-2515785 AGGGCCGGCCACACCAAGCCTGG - Intronic
1078287433 11:9971534-9971556 TGGGCAGGCACCACCATGCCTGG - Intronic
1078733068 11:13993469-13993491 TGGCTGGGCCACAGCATTCCAGG - Intronic
1081670211 11:44938459-44938481 TGGGGAGGCCTCAGCAGGCCTGG - Intronic
1083790033 11:64978613-64978635 TGGGGAGGCCTCAGCATGGCGGG + Intergenic
1084001996 11:66300937-66300959 TAGGCTACCCACAGCATGGCAGG + Intergenic
1084088163 11:66864244-66864266 AGGGCTGGCCCCTGCCTGCCCGG - Intronic
1084517400 11:69644276-69644298 TGGAGTGGCCACAGGCTGCCTGG - Intronic
1084781312 11:71411269-71411291 TTGGTTGGCCACACCATGCTGGG - Intergenic
1084951909 11:72671130-72671152 TGGGGGGCCCACAGCAAGCCTGG - Intronic
1085104156 11:73827527-73827549 TGGGGTGGATACAGCATGCAAGG + Intronic
1085396831 11:76210629-76210651 TGAGCCGGCCGCAGCTTGCCAGG - Intronic
1085463534 11:76709444-76709466 TGGGGTGTGGACAGCATGCCTGG - Intergenic
1086092912 11:83021654-83021676 TGAGCTGAGCACAGCCTGCCAGG + Intronic
1086450306 11:86909143-86909165 CAGGCTAGCCACAGCCTGCCTGG + Intronic
1086569070 11:88262546-88262568 TGGGCTGCCCACTGCATCTCTGG + Intergenic
1086700622 11:89896966-89896988 AGGGCTGCCCGGAGCATGCCAGG + Intergenic
1086705547 11:89947560-89947582 AGGGCTGCCCGGAGCATGCCAGG - Intergenic
1087037775 11:93772227-93772249 TGAGCTGAGCACAGCCTGCCAGG - Intronic
1087255319 11:95946628-95946650 GGGGCTGGGCAAAGCATGACAGG + Intergenic
1089170943 11:116511126-116511148 TGGTCTTGCCACAGCAGCCCTGG + Intergenic
1089326114 11:117658426-117658448 TGGGCAAGCCACAGCTTTCCGGG - Intronic
1090156336 11:124442079-124442101 TGCACTGACCTCAGCATGCCAGG + Intergenic
1090370988 11:126252462-126252484 TGGGCTGGGCACAGCAGCTCAGG + Intronic
1091288035 11:134419679-134419701 GTGGCTGGCCACACCAGGCCAGG - Intergenic
1091692005 12:2603682-2603704 TGGCTTGGCCTCAGCATCCCAGG + Intronic
1092002545 12:5044213-5044235 TGGCCTGGCCGCAGCCTGCCCGG - Exonic
1092271896 12:7030351-7030373 TGAGCTGACCACAACCTGCCAGG - Intronic
1093281949 12:17205042-17205064 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1094856206 12:34403969-34403991 TGGGCTGGCCCCAGTGGGCCTGG - Intergenic
1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG + Intronic
1098790693 12:74817753-74817775 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1099006254 12:77237955-77237977 TGAGAAGGCCACAGCATGCAAGG - Intergenic
1102255487 12:111412340-111412362 TGGGCTGGCAACTTCCTGCCCGG + Intronic
1102491319 12:113291137-113291159 TGGGGAGGCCACAGGATGGCTGG + Intronic
1103699457 12:122841271-122841293 TGGGCCAGCCACAGCGTGTCAGG - Intronic
1103910870 12:124351404-124351426 TGGGCTGTTAACAGCATCCCTGG + Intronic
1105551209 13:21397517-21397539 TGGGCAGGCACCACCATGCCCGG - Intronic
1109851946 13:68076312-68076334 TGGGCCGAGCACAGCCTGCCAGG + Intergenic
1111253542 13:85638345-85638367 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1112336510 13:98521561-98521583 TGGGAATGCCACAGAATGCCCGG + Intronic
1112858241 13:103797489-103797511 TGGCCTGTTCACAGCATGGCAGG - Intergenic
1113553100 13:111208581-111208603 TCTGCTGGCCACAGCCTTCCAGG - Intronic
1113655698 13:112066962-112066984 TGGGCTGCCCGCTGCCTGCCCGG - Intergenic
1113676884 13:112213881-112213903 TTGCCTGGCCACAGCCAGCCAGG + Intergenic
1114565914 14:23632738-23632760 TGGAGTGGCCAGAGCATGTCTGG + Intronic
1117076118 14:52106583-52106605 TGGCATGGCCACTGCATGGCGGG + Intergenic
1119473433 14:74913049-74913071 ATGGCTGGCCACAGCCTCCCTGG - Intronic
1121365119 14:93301998-93302020 TGGGCTGGGCAAAGCATGTGAGG + Intronic
1121773977 14:96578140-96578162 AGGGCAGTCAACAGCATGCCAGG - Intergenic
1121857553 14:97283953-97283975 TGGGCTGGAGGCAGCATGTCAGG - Intergenic
1122373382 14:101242011-101242033 TGGGCAGGCCACAGGAAGCCAGG - Intergenic
1122843603 14:104478651-104478673 AGGCCTGGCCACTGCATCCCAGG + Intronic
1123058018 14:105581584-105581606 TGTGCTGGGCACAGCCTGCCAGG + Intergenic
1202842125 14_GL000009v2_random:131550-131572 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1202881101 14_KI270722v1_random:60842-60864 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1123808336 15:23897727-23897749 TGGGCTGGGCGCAGCCTGACCGG + Intergenic
1124437488 15:29663040-29663062 TGGGCTGGGCACGGGATTCCGGG - Intergenic
1125620758 15:41059480-41059502 TAGGCTCGCTACACCATGCCCGG - Intronic
1126174204 15:45720774-45720796 AGGGCATCCCACAGCATGCCTGG - Intergenic
1127547931 15:60006504-60006526 TGGGCCGACCACAGCTTCCCGGG + Exonic
1128426112 15:67543330-67543352 AGGGCTAGCCACAGCATTACAGG - Exonic
1130091587 15:80825572-80825594 TGGCCAAGCCACAGCATGCATGG + Intronic
1131055629 15:89372791-89372813 GGGGCTGGCCAGTGAATGCCGGG - Intergenic
1132588803 16:717492-717514 TGGGCTGGACACAGGAGACCAGG - Exonic
1133770266 16:8863647-8863669 TGGGGTGGCCAGAGTAGGCCTGG + Intronic
1133854043 16:9532895-9532917 TGTGTTTGCCACAGCATGTCAGG - Intergenic
1134443527 16:14313714-14313736 TGCGCCAGCCACAGCAGGCCAGG + Intergenic
1135193562 16:20375735-20375757 TGGCCTGGCCCAAGCATGGCTGG + Intronic
1136682489 16:31976322-31976344 TGGGGTGGCCACAGCCACCCTGG + Intergenic
1136782749 16:32917490-32917512 TGGGGTGGCCACAGCCACCCTGG + Intergenic
1136887048 16:33936360-33936382 TGGGGTGGCCACAGCCACCCTGG - Intergenic
1139061830 16:63262878-63262900 TGGGCTGCACACAGCAGCCCTGG + Intergenic
1140327047 16:74014593-74014615 TAGGCTGGCTAAAGCATGGCAGG + Intergenic
1140423157 16:74837292-74837314 TGAGCTTGCCAAGGCATGCCAGG + Intergenic
1141008640 16:80376477-80376499 TGGGCTGGCCTCTGCAGGCGGGG - Intergenic
1141640486 16:85338139-85338161 TGGGCTGCCCACGGCAGGGCAGG + Intergenic
1141767389 16:86067706-86067728 AGGTGTGGCCACAGCATCCCAGG - Intergenic
1142031262 16:87839647-87839669 CGGGCTGGCCACAGCCTCTCAGG + Intronic
1142066839 16:88067689-88067711 AGGGGTGGCCAGAGCATGGCAGG - Intronic
1203085400 16_KI270728v1_random:1181474-1181496 TGGGGTGGCCACAGCCACCCTGG + Intergenic
1143205810 17:5138816-5138838 TGGGCTGCCCAGTCCATGCCAGG - Intronic
1143431933 17:6894136-6894158 TGGGGTGGGCACGGCAGGCCCGG + Intronic
1143526945 17:7478709-7478731 TGAGCAGGGCACAGCATGCTGGG - Intronic
1143918087 17:10309471-10309493 TGGACGGGCCCCAGCCTGCCAGG - Intronic
1145249122 17:21287896-21287918 GGGGGTGGCCACAGCAGGCAGGG - Intronic
1145795734 17:27654377-27654399 TGGGCTTGACACAGCCAGCCTGG + Intergenic
1145796830 17:27660495-27660517 TGGGGTGGCCAGAGGATGCCAGG + Intergenic
1145834593 17:27944708-27944730 TCTGCAAGCCACAGCATGCCAGG + Intergenic
1146007128 17:29167568-29167590 TGGGCATGCACCAGCATGCCTGG - Intronic
1146139014 17:30348649-30348671 CGGGCTCCCCACACCATGCCTGG - Intergenic
1146785781 17:35720111-35720133 CGGGCTGGGCACAGGATGACAGG + Intronic
1146808979 17:35888463-35888485 TGGGCTGGGCAAAGCATGTGAGG + Intergenic
1146842801 17:36166979-36167001 TGGGCTGCCCAGTCCATGCCAGG + Intronic
1146855114 17:36254938-36254960 TGGGCTGCCCAGTCCATGCCAGG + Intronic
1146865506 17:36333437-36333459 TGGGCTGCCCAGTCCATGCCAGG - Intronic
1146871014 17:36378831-36378853 TGGGCTGCCCAGTCCATGCCAGG + Intronic
1146878372 17:36429913-36429935 TGGGCTGCCCAGTCCATGCCAGG + Intronic
1146882321 17:36451059-36451081 TGGGCTGCCCAGTCCATGCCAGG + Intergenic
1147068375 17:37934049-37934071 TGGGCTGCCCAGTCCATGCCAGG - Intronic
1147073898 17:37979455-37979477 TGGGCTGCCCAGTCCATGCCAGG + Intronic
1147079898 17:38013586-38013608 TGGGCTGCCCAGTCCATGCCAGG - Intronic
1147085419 17:38058993-38059015 TGGGCTGCCCAGTCCATGCCAGG + Intronic
1147095847 17:38137546-38137568 TGGGCTGCCCAGTCCATGCCAGG - Intergenic
1147101366 17:38182959-38182981 TGGGCTGCCCAGTCCATGCCAGG + Intergenic
1147326607 17:39672655-39672677 TGGGCTGGCCACATGATTCTGGG + Exonic
1147537004 17:41327798-41327820 TGGGCTGCCCAGTCCATGCCGGG - Intergenic
1147844660 17:43396586-43396608 TTGAGTGGCCACTGCATGCCAGG - Intergenic
1147882097 17:43660690-43660712 GGGGCTGGCCAAAGCATGGTGGG + Intronic
1148683296 17:49486784-49486806 TGGGCTTGCCCCAGGTTGCCTGG + Intergenic
1149845963 17:60009465-60009487 TGGGCTGCCCAGTCCATGCCAGG + Intergenic
1150084312 17:62266045-62266067 TGGGCTGCCCAGTCCATGCCAGG + Intergenic
1151832224 17:76560291-76560313 TGGACTGGCCACATGATTCCTGG - Intergenic
1152290236 17:79436210-79436232 GGGGCTGCCCACAGGATGCCTGG + Intronic
1152613594 17:81328055-81328077 TGGCCTGGACACAGCCTGGCAGG + Intronic
1153428681 18:4992245-4992267 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1157490029 18:48116680-48116702 TGTCCTGGCCACTGCTTGCCTGG + Intronic
1157560963 18:48645730-48645752 GGGGCTGGCCTCATCATCCCTGG - Intronic
1157897260 18:51480986-51481008 TGGGCTGGGAAGAGCCTGCCTGG + Intergenic
1157905526 18:51566453-51566475 TTGGCTGCCCAAAGCAGGCCAGG + Intergenic
1160083473 18:75753155-75753177 TGGTCTGGCCACAGCCTTGCAGG - Intergenic
1160909626 19:1468695-1468717 TGGGCTGGGCACGGGGTGCCGGG - Exonic
1161780354 19:6287561-6287583 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1162931375 19:13959508-13959530 TGGGCTGGCCTCTCCATCCCAGG - Intronic
1163271937 19:16259732-16259754 TTGGCTGGCCACATCACCCCTGG - Intergenic
1163365868 19:16875896-16875918 TGGTCTGCCCACAGCCTGTCAGG + Intronic
1163513934 19:17751697-17751719 TGGGCTGGCCAAAGCCTGCATGG + Intronic
1163830938 19:19546896-19546918 GGGGCAGGCAACAGCAAGCCAGG + Intergenic
1164416478 19:28050158-28050180 TGGGCTGGCCACAGCAAGGATGG + Intergenic
1164710607 19:30354561-30354583 TAGGAGGCCCACAGCATGCCAGG - Intronic
1165330133 19:35136917-35136939 TGGGCGTGCGACACCATGCCTGG - Intronic
1165603498 19:37078654-37078676 TGTGCAGGCTACAGCCTGCCTGG + Intronic
1168403869 19:56100795-56100817 TGGCCTGGCCATAGCATGTGGGG - Intronic
1168403937 19:56101071-56101093 TGGCCTGGCCATAGCATGTGGGG - Intronic
1202656709 1_KI270708v1_random:29947-29969 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
925445940 2:3927137-3927159 AGGGCTGGAAACAACATGCCAGG - Intergenic
926224055 2:10954956-10954978 AGGGCTGGCCACAGAAACCCTGG + Intergenic
926308532 2:11657814-11657836 TGCGCTGGCCAGAGCATAACTGG + Intergenic
926546347 2:14245200-14245222 TGGGCTGAGCACAGCCTGCCAGG + Intergenic
926628221 2:15112601-15112623 TTGGATTGCCAAAGCATGCCTGG - Intergenic
927577003 2:24208511-24208533 TTGGCTGACCACAAAATGCCAGG + Intronic
927613436 2:24565659-24565681 TGAGCTGCACACAGCCTGCCAGG - Intronic
927845641 2:26470996-26471018 TGTGCTGGCCCAAGCATGCGGGG + Intronic
927903441 2:26840254-26840276 TGGCATGGACACAGTATGCCAGG - Intergenic
927957963 2:27221373-27221395 TGGGCAGAGCACAGCATGCCTGG + Intronic
929570811 2:43021895-43021917 TGGGCCGGCTGCAGCAAGCCTGG - Intergenic
929657740 2:43750970-43750992 TGGGCTGGAGACAGGCTGCCTGG + Intronic
929864853 2:45709228-45709250 TGGGCTGGGGCCAGCATACCGGG + Intronic
931460137 2:62443303-62443325 GGGGCTGGCCACAGAATTGCTGG + Intergenic
932096172 2:68850813-68850835 TGAGCTGGACCCAGCCTGCCTGG - Intergenic
934504192 2:94878800-94878822 TGGGGTGGGCACAGCATGGGGGG - Intergenic
935237172 2:101149360-101149382 AGAGCTGGCCATAGGATGCCTGG - Intronic
937402131 2:121593474-121593496 TAGGCAGGCACCAGCATGCCCGG - Intronic
937877666 2:126837493-126837515 TGGGCTGGCCTATGCTTGCCCGG + Intergenic
938373133 2:130786371-130786393 TGCGCTGGCCGCAGCAGCCCAGG - Intergenic
940396147 2:153195300-153195322 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
942045168 2:172095682-172095704 TGGGCTGGCGGCGGCGTGCCTGG + Intergenic
943022339 2:182590323-182590345 TGGGCGGGCACCACCATGCCTGG - Intergenic
943247593 2:185474481-185474503 TGAGCTGAGCACAGCCTGCCTGG + Intergenic
945002890 2:205370516-205370538 TGGCCTGCCAACAGCAGGCCCGG + Intronic
948236108 2:236391891-236391913 TGGACATGCCACAGCATGTCAGG + Intronic
948571947 2:238923164-238923186 TGGGCTGGACACAGCATCCCTGG - Intergenic
948886630 2:240888167-240888189 TGACCTGGCCTCAGCATTCCTGG + Intronic
1169075699 20:2758817-2758839 TGGGCTGGAGACAGCAGGCAGGG - Intronic
1169277585 20:4244040-4244062 TGGCCTGACCACAGCATTCCAGG + Intronic
1169609835 20:7365933-7365955 TAGGTTGGCCACAGTTTGCCAGG - Intergenic
1169702065 20:8457795-8457817 TGTGCAGGAGACAGCATGCCAGG - Intronic
1169819115 20:9689312-9689334 TAGGCTGGCCACAGAATGAAAGG - Intronic
1170008749 20:11697592-11697614 TGGGCTGGACAGAGTATGGCTGG - Intergenic
1170568723 20:17621123-17621145 TGGGCTGGCCAGAGAGTGGCAGG + Intronic
1171852704 20:30319776-30319798 AGGGCTGCACACAGGATGCCAGG - Intergenic
1172767238 20:37357288-37357310 TGGGCTGGCTACAGCTGCCCTGG + Intronic
1173640539 20:44598700-44598722 TGGGGAGGACCCAGCATGCCCGG + Exonic
1173872794 20:46352263-46352285 TGGGCTGGCCAAGGCAGCCCAGG - Intronic
1173884413 20:46445093-46445115 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1174388378 20:50200691-50200713 TGGGCTGGCCCCAGGAAGGCTGG - Intergenic
1175958604 20:62623843-62623865 TGGGCTGGTCTCAGCCTGCAGGG - Intergenic
1176071146 20:63226966-63226988 TGGCCATGCCACAGCAGGCCAGG + Intergenic
1176180431 20:63747168-63747190 TGTGCTGGCCGCGGCATGGCCGG - Exonic
1176247427 20:64104157-64104179 GGGCCTGGCCACAGCACACCTGG + Intergenic
1176630873 21:9136452-9136474 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1176990964 21:15495912-15495934 TGGGCTAGGCCCAGCATGACTGG - Intergenic
1179557818 21:42191751-42191773 AGGCCTGTCCACAGCAGGCCAGG - Intergenic
1180375714 22:12091154-12091176 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1180984059 22:19893710-19893732 TGGGCTGGCTACAACTTGCTGGG - Intronic
1182152078 22:28034837-28034859 TGGGCTTGTCACAGGATCCCTGG - Intronic
1183101689 22:35588060-35588082 GGGCCTGGGCACAGGATGCCTGG + Intergenic
1183526832 22:38328055-38328077 TGCGCCGGCCCCAGCTTGCCAGG + Intronic
1183714399 22:39525321-39525343 TGGGCTGGCCAAGGCCTGGCAGG - Intergenic
1184032643 22:41904016-41904038 TGGTCTGCTCACAGCATGGCTGG + Intronic
1184206577 22:43007824-43007846 GGTCCTGGCCACTGCATGCCTGG - Intronic
1184721388 22:46316112-46316134 AGAGCTGGCCGCAGCATGGCGGG - Exonic
1185075571 22:48680375-48680397 TGGGCAGGCAACTGCATGGCGGG - Intronic
949218415 3:1600288-1600310 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
950586146 3:13894030-13894052 TGTGCTTGCCACAGTGTGCCAGG - Intergenic
950618050 3:14178313-14178335 AGGGCCGGCCGCAGCCTGCCGGG + Intronic
950624647 3:14235979-14236001 CTGGCTGGCCACAGTGTGCCGGG - Intergenic
951562287 3:23981241-23981263 TGAGCTGGGTACAGCCTGCCAGG - Intergenic
953450494 3:43001401-43001423 TGGCCTGGCCAGAGCAGGGCAGG + Intronic
953882739 3:46700123-46700145 TTGCCTGGCCAGGGCATGCCTGG + Intergenic
954131102 3:48561306-48561328 TGTACTGGCCACAGCGTGGCCGG - Intronic
954410403 3:50368078-50368100 TGGGCTGGCCCCATGCTGCCTGG + Intronic
955823440 3:62920759-62920781 TGGTCTGGCCACAGCTTGCCAGG - Intergenic
956794075 3:72702465-72702487 TGGGACGCCCACGGCATGCCTGG - Intergenic
957097695 3:75792274-75792296 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
961009259 3:123425032-123425054 TGGGCTGCACTCAGGATGCCTGG - Intronic
962211870 3:133486357-133486379 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
962810449 3:138955114-138955136 TGGGCTTGGCTCAGCATGCTGGG - Intergenic
963805299 3:149715577-149715599 TGAGCTGAGCACAGCCTGCCAGG + Intronic
968085127 3:195870747-195870769 TGGGCTGGCCACAGCATGCCAGG + Intronic
968164417 3:196452884-196452906 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
968575820 4:1365689-1365711 TGGTGTGACCACAGCATGTCAGG - Intronic
968627196 4:1631291-1631313 TTTGCTGCCCACAGCAGGCCTGG - Intronic
968640349 4:1711704-1711726 TGGGGCGGCCGCAGCAGGCCTGG - Intronic
968733728 4:2284524-2284546 TGGGCTGAGCACAGCCTCCCAGG + Intronic
968966051 4:3769590-3769612 TGGGCTGGGCTCAGCAGGCAGGG - Intergenic
969176630 4:5403730-5403752 TGTGCTACCCCCAGCATGCCAGG + Intronic
969866179 4:10078355-10078377 TGGTCTGGTCACAGTGTGCCTGG - Intronic
972106606 4:35495301-35495323 TGAGCTGAACACAGCCTGCCAGG + Intergenic
972608511 4:40635568-40635590 TGGGCTGGCTACTGCATTCTAGG - Intergenic
972750283 4:41981386-41981408 TGGGCTCACAACACCATGCCAGG - Intergenic
973587956 4:52411048-52411070 TGGGCTGACAAGAGTATGCCTGG - Intergenic
975393443 4:73847649-73847671 TGGGTTGGGCACAGCTTGACAGG + Intronic
976700925 4:87967494-87967516 TGAGCTGAACACAGCCTGCCAGG + Intergenic
976749207 4:88437197-88437219 TGGGCATGCGACACCATGCCTGG + Intronic
977472003 4:97453414-97453436 TGAGCTGGGCACAGCCTGCCAGG + Intronic
978466875 4:109017340-109017362 TGAGCTGAGCACAGCCTGCCAGG + Intronic
978927654 4:114268691-114268713 GGGGCTGAGCACAGCATGTCTGG - Intergenic
979119099 4:116870901-116870923 TGTGCTTGTCACAGGATGCCTGG + Intergenic
979448084 4:120838816-120838838 TGAGCTGAACACAGCCTGCCAGG - Intronic
980243320 4:130203864-130203886 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
1202757312 4_GL000008v2_random:76595-76617 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
985527903 5:416340-416362 TGGTCTGGCCACAGCCTGGCAGG - Intronic
986044140 5:4021537-4021559 TAGGCTGGCAACACCATGCCAGG - Intergenic
986179338 5:5378841-5378863 TGGGCCGTCCACAGCATCACAGG - Intergenic
986326257 5:6677113-6677135 TGGGGTGGAAACAGCATGCTGGG + Intergenic
988225359 5:28405184-28405206 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
989098256 5:37800873-37800895 TGGGCTGGCAACACCATGGCTGG - Intergenic
990222153 5:53604756-53604778 TGGTCTAGCCACACCAAGCCTGG + Intronic
990976368 5:61564975-61564997 TGGGCCAGCCACAACATGGCTGG - Intergenic
993227229 5:85182547-85182569 CAAGCTGGTCACAGCATGCCTGG + Intergenic
995012375 5:107271822-107271844 TGGGCTGGCCAAAGTTTGCATGG - Intergenic
997208456 5:132064205-132064227 TGGACTGTCCACACCATCCCAGG + Intergenic
997261295 5:132467271-132467293 TGGCCTGGTCCCAGCTTGCCAGG + Intronic
997693579 5:135844204-135844226 GGGGCTGGGCACAGCCTCCCTGG + Intronic
998135371 5:139671554-139671576 TGGGCTGCCCACAGGATTCTGGG + Intronic
998379827 5:141716264-141716286 GAGGCAGGCCACAGCTTGCCTGG + Intergenic
999212931 5:149905998-149906020 TGGGCTTGCACCACCATGCCTGG + Intronic
999267229 5:150274824-150274846 TGGGCATGGCCCAGCATGCCAGG - Intronic
1000004203 5:157168090-157168112 TATGGTGGCAACAGCATGCCTGG - Intronic
1001694319 5:173658833-173658855 TAGGCTGGCAGCAGGATGCCTGG - Intergenic
1002078753 5:176725565-176725587 CGGGCTTGACACAGGATGCCAGG - Intergenic
1002575377 5:180171098-180171120 GGGGAAGGCCACAGGATGCCTGG - Intronic
1003231250 6:4255681-4255703 TAGGCTGGACCCACCATGCCTGG - Intergenic
1006132642 6:31878399-31878421 TGGGCTGGCCTCTGCCTGCCAGG - Intronic
1006405938 6:33844846-33844868 TCGGCAGGCCTCATCATGCCTGG - Intergenic
1006463362 6:34176851-34176873 AAGGCTGCCCACATCATGCCTGG + Intergenic
1007662875 6:43497144-43497166 TGGGATGACCAAAGCATCCCCGG + Intronic
1012183147 6:96180379-96180401 TACTCTGGACACAGCATGCCTGG - Intronic
1014418613 6:121214343-121214365 TGAGCTGAGCACAGCTTGCCAGG - Intronic
1015119180 6:129682674-129682696 TTGACTGTCCACAGCCTGCCTGG + Intronic
1016076630 6:139804270-139804292 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1016200141 6:141395919-141395941 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1016505164 6:144771126-144771148 TGATCTGGCCACATCAAGCCAGG + Intronic
1016524762 6:144989273-144989295 TGGGCTGGCAACAGTGAGCCTGG - Intergenic
1016760321 6:147729436-147729458 TTGGCTGCCCACTGTATGCCAGG + Intronic
1016885035 6:148951123-148951145 TTGGCTGGCCACAGCATGTGTGG + Intronic
1017066596 6:150534888-150534910 TGGCCTGGCCACAGCATCGATGG - Intergenic
1017826609 6:158086408-158086430 GGCACTGGCCACTGCATGCCAGG + Intronic
1017834202 6:158162056-158162078 TGGGCGTGCCACACCATGCAAGG - Intronic
1018659837 6:166076064-166076086 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1018707141 6:166471194-166471216 TGTGCTGACCACAGCATCCCCGG - Intronic
1020682742 7:11256960-11256982 TAGGGTGGCCACAGCATCCAAGG + Intergenic
1021677814 7:23098302-23098324 TGAGCTGAGCACAGCTTGCCAGG + Intergenic
1022517442 7:30984834-30984856 TGACTTGGCCACAGGATGCCTGG + Intronic
1023056666 7:36296173-36296195 TGGGCTGCCCATTGAATGCCAGG + Intronic
1023792396 7:43763257-43763279 TGTGATGGCCACAGCAGGTCTGG - Intronic
1024292737 7:47816839-47816861 TGGGCTGTAGACAGCAGGCCTGG + Intronic
1025012169 7:55406312-55406334 TAGGCTGGCCAGAGCGTCCCTGG + Intronic
1025192178 7:56904211-56904233 TGGGCTGGCATCTGCCTGCCCGG - Intergenic
1027681823 7:81232200-81232222 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1028024728 7:85822237-85822259 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1029217985 7:98965601-98965623 TGGGCAGAACCCAGCATGCCAGG + Intronic
1029655682 7:101922851-101922873 TGGGCTGGCCACAGCATGTCAGG + Intronic
1029715048 7:102321240-102321262 TGGGCTGGCCACATCCTGCAGGG - Intronic
1032638776 7:133741292-133741314 TGAGCTGACCTGAGCATGCCAGG + Intronic
1035703266 8:1653396-1653418 TGGGATGGCCACGGGATACCCGG - Intronic
1035777985 8:2203977-2203999 TGGGGTGGCCCCACCGTGCCTGG - Intergenic
1036127406 8:6075674-6075696 TAGGCTGGCCAGACCATGCAAGG - Intergenic
1037083593 8:14818061-14818083 TGGGCTGGGCACAGAAGGGCCGG - Intronic
1037674418 8:21041526-21041548 TGGGGTGGCCTCAGCAGCCCCGG - Intergenic
1039192734 8:34995392-34995414 TGAGCTGGCTAAATCATGCCTGG - Intergenic
1039839814 8:41285591-41285613 TGGGCTGGCCTCAGGGTCCCTGG - Intronic
1043087032 8:75848576-75848598 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1048576221 8:135692061-135692083 AGGGCAGCCCTCAGCATGCCAGG - Intergenic
1049221578 8:141431111-141431133 TGGGCTGGGCAGAGCAGGGCTGG - Exonic
1049348509 8:142151863-142151885 AGGGCTGGGCCCAGCAGGCCAGG - Intergenic
1049526340 8:143128571-143128593 AGGCCTGGCCACAGCAGGCAAGG + Intergenic
1049547133 8:143237973-143237995 TGGGCGTGCAACGGCATGCCTGG - Intergenic
1049660223 8:143816419-143816441 TGGGCTGGGCAGAGCGCGCCTGG + Exonic
1052621431 9:30914964-30914986 TAGGCAGGCAACACCATGCCTGG + Intergenic
1053023088 9:34709187-34709209 TGAGCTGCCCACAGCAGGCCAGG - Exonic
1055554305 9:77459869-77459891 TGGGCAGGGCACAGAATGCCTGG - Intronic
1056679811 9:88706984-88707006 TGGGCTGGCCACTGCAGGGTTGG + Intergenic
1056852436 9:90095793-90095815 TGGGCTGGCCTCAGCAAGGGTGG - Intergenic
1057468701 9:95338617-95338639 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1059725970 9:117008397-117008419 TGGGCTTGCAACACCATGACGGG - Intronic
1059824938 9:118017784-118017806 TGGGCTGGCCCCAGCAACCCTGG - Intergenic
1060771590 9:126335997-126336019 TGAGCTGGCCTCACCATGGCAGG + Intronic
1061194686 9:129101254-129101276 TGTGCGGGGCCCAGCATGCCGGG + Intronic
1062100306 9:134724543-134724565 GGGTCTGGCCACAGCAAGACAGG - Intronic
1062293854 9:135813141-135813163 TGGGAAGGCCTCAGGATGCCTGG - Intronic
1062385463 9:136309292-136309314 TGGGCAGGCCCAAGCAGGCCTGG + Intergenic
1062477075 9:136733627-136733649 GGGGCTGGCCACAGCAGACAAGG + Intergenic
1203688911 Un_GL000214v1:23651-23673 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1203753703 Un_GL000218v1:104154-104176 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1203538102 Un_KI270743v1:61456-61478 TGAGCTGAGCACAGCCTGCCAGG + Intergenic
1203647364 Un_KI270751v1:80402-80424 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1185481137 X:447216-447238 TGGGCATGCCCCACCATGCCTGG + Intergenic
1185833010 X:3319495-3319517 GTGGCTGGCCACTGCAAGCCTGG - Intronic
1186086238 X:5993617-5993639 GGGGCTGGCCACACCATACTTGG + Intronic
1186294691 X:8136050-8136072 TGGGCTTGCACCACCATGCCTGG + Intergenic
1187871072 X:23766010-23766032 TGAGCTGAGCACAGCCTGCCAGG - Intronic
1189726219 X:43970178-43970200 AGGGCAGGCCACAGCAACCCAGG + Intronic
1190266347 X:48829399-48829421 TGTGCTGGACACAGCAGGGCAGG + Exonic
1193097789 X:77571180-77571202 TGACCTAGCCACAGCATACCTGG + Intronic
1193210481 X:78801724-78801746 TAGGCTGCACACAGCAGGCCGGG - Intergenic
1193468610 X:81874470-81874492 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1198189609 X:134288885-134288907 TGAGCCGACCACAGCCTGCCAGG + Intergenic
1200052386 X:153441492-153441514 TCGGCATGCCACGGCATGCCAGG + Intergenic
1201167345 Y:11221713-11221735 TGAGCTGAGCACAGCCTGCCAGG - Intergenic
1201243089 Y:11977396-11977418 GGGGCTGGCCACTACAAGCCTGG + Intergenic