ID: 968087364

View in Genome Browser
Species Human (GRCh38)
Location 3:195879865-195879887
Sequence AACAGCACGATGAAGTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968087364_968087369 16 Left 968087364 3:195879865-195879887 CCCGCCCACTTCATCGTGCTGTT 0: 1
1: 0
2: 1
3: 9
4: 111
Right 968087369 3:195879904-195879926 CATACCTTACCATGCAAACCAGG 0: 1
1: 0
2: 3
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968087364 Original CRISPR AACAGCACGATGAAGTGGGC GGG (reversed) Intronic
904266664 1:29322258-29322280 AACAGCTCCCTGCAGTGGGCAGG + Intronic
904296619 1:29523520-29523542 CACAGCAGGAAGAGGTGGGCTGG - Intergenic
905886461 1:41494567-41494589 AACAGCCCTAGGAAGAGGGCAGG + Intergenic
906018128 1:42601383-42601405 AATAGCACGATTTTGTGGGCTGG - Intronic
907389617 1:54149855-54149877 AACAGCCCCATGAACTAGGCAGG + Intronic
907834579 1:58096997-58097019 AAGACCACACTGAAGTGGGCAGG + Intronic
908078043 1:60542737-60542759 AGCAGCACCATGAGTTGGGCAGG + Intergenic
908797015 1:67840276-67840298 TACAGCATGATGAGGGGGGCAGG - Intergenic
916560842 1:165933221-165933243 AACAACTCTATGAAGTAGGCAGG + Intergenic
924285059 1:242477301-242477323 AACAACACCATGCAGTGGCCAGG - Intronic
1062860085 10:804220-804242 GACAGCAAGATGAAGTTTGCAGG + Intergenic
1063552713 10:7048265-7048287 AACAGCAGGATGAAGCCAGCAGG + Intergenic
1067299065 10:44993005-44993027 AACAGCACACTGGAGTGGACAGG - Intronic
1067706803 10:48612115-48612137 AAAAGCAGGAGGAAGTTGGCTGG - Intronic
1074735454 10:116426798-116426820 AACAGCACCAAGCAGTGTGCTGG - Intergenic
1075875768 10:125804385-125804407 AACAGCCAGATGAAGAGGTCTGG - Intronic
1076618624 10:131772656-131772678 AACAGCACGTTGAAGTGCAGTGG + Intergenic
1079316302 11:19410563-19410585 ATCAGCACAATGTAGTGGCCAGG - Intronic
1080575244 11:33592944-33592966 AAAAGCAGGATCAAGGGGGCTGG + Intronic
1083822835 11:65182375-65182397 GACAGCACAAGGAACTGGGCAGG - Intronic
1089750285 11:120646888-120646910 AACAGCCTGGTGAAGTAGGCAGG + Intronic
1094306919 12:29030527-29030549 AACAGCACTATGAAATAGGTAGG + Intergenic
1095131181 12:38544494-38544516 AACAGCAGCATGCAATGGGCTGG - Intergenic
1099067796 12:78005781-78005803 AACAGCCCATTGAAGTGGGAAGG - Intronic
1100353314 12:93805525-93805547 AACAGCTCGATGTACTGGGTAGG - Intronic
1102391233 12:112550401-112550423 AACAGCACTTTGAGGTAGGCGGG - Intergenic
1102805038 12:115772257-115772279 AAGAACACCATGAAGTGGGAAGG - Intergenic
1105591842 13:21799715-21799737 AACAGAAAAATGAAGAGGGCAGG - Intergenic
1107065599 13:36211583-36211605 AACAGCTTGATGCAGTGGGAAGG + Intronic
1109421271 13:62115597-62115619 AAAAGCAGGATGGAGTGGGAAGG - Intergenic
1111112858 13:83736999-83737021 AATAGCAAGATGAAGTAGACTGG + Intergenic
1111478935 13:88795561-88795583 AACAGAAGAATGAGGTGGGCTGG - Intergenic
1112346995 13:98598199-98598221 AACATCCGAATGAAGTGGGCAGG - Intergenic
1117924777 14:60766833-60766855 AACAACAAGATGAATTGGGTAGG + Intronic
1118779160 14:68994812-68994834 AACACCACAAGGAAGTGGGCAGG + Intergenic
1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG + Intronic
1120942314 14:89960501-89960523 AACAACCCCTTGAAGTGGGCTGG + Intronic
1121340996 14:93105088-93105110 AACAGCAGGTAGAACTGGGCTGG + Intronic
1121540001 14:94718457-94718479 AACAGCCTGCTGAAGTGGACAGG + Intergenic
1123062575 14:105600890-105600912 GACAGCACCAAGAAGTGTGCAGG - Intergenic
1124619463 15:31265605-31265627 AACAGCACTCAGGAGTGGGCGGG + Intergenic
1127002588 15:54527130-54527152 AACATCCCGGTGAAGTAGGCAGG - Intronic
1132976251 16:2712549-2712571 ACCAGCAGGATGGTGTGGGCGGG + Exonic
1135477153 16:22786644-22786666 CACAGCAAGATCAAGTAGGCAGG - Intergenic
1139362435 16:66408754-66408776 AACAGCAGCATGTACTGGGCAGG + Intergenic
1143986876 17:10922339-10922361 AACATCACGATGCAGTGGGCAGG - Intergenic
1144787997 17:17842443-17842465 GACAGGTCCATGAAGTGGGCAGG - Intergenic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148206278 17:45782293-45782315 ATCATCACGATGGAGTGGACTGG - Intergenic
1148700146 17:49582198-49582220 ACCATCACGACGAAGTGCGCTGG + Intronic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1151751581 17:76041667-76041689 AACAGCACAGGGATGTGGGCAGG - Intronic
1156685233 18:39637132-39637154 CACAGTAGGATGAAGTGGGTGGG - Intergenic
1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG + Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166053964 19:40277672-40277694 GAGAGCCCGAGGAAGTGGGCTGG - Intronic
926008860 2:9393056-9393078 AGCAGCCCGATGAAGTGGGTAGG + Intronic
927571830 2:24166910-24166932 AACAGCAAGAAAAAGTGGGGAGG + Intronic
927876055 2:26655849-26655871 AACAGCAAAAGGAAGGGGGCAGG - Intergenic
930019054 2:46990095-46990117 AGCAGCAGGCTGAAGAGGGCTGG - Intronic
930075718 2:47403899-47403921 AGCAGTATGATGAAGTGGTCAGG + Intronic
931147763 2:59538479-59538501 AAAAACACCATGAAGTGTGCTGG - Intergenic
931235471 2:60409153-60409175 AAAAGCAGGACAAAGTGGGCAGG - Intergenic
941055464 2:160782987-160783009 AAATGCACTAAGAAGTGGGCAGG + Intergenic
944141040 2:196457393-196457415 GACAGTACCATGTAGTGGGCAGG - Intronic
947496848 2:230643913-230643935 AACAGCAGGTTTGAGTGGGCAGG + Intergenic
947789720 2:232857983-232858005 TACAGGAGGATGCAGTGGGCTGG + Exonic
948813678 2:240499050-240499072 AACAGCACGTGGAAGTGTGTGGG + Intronic
1171490951 20:25516795-25516817 ACCAGCAAGAGGAAGTGGGAAGG + Intronic
1172063321 20:32202110-32202132 AGCAGGAGGAGGAAGTGGGCTGG - Exonic
1175650828 20:60721156-60721178 AACAGCCAGATGAAAGGGGCCGG + Intergenic
1177854931 21:26390156-26390178 AAGAGCATGATGAGGTGGGGTGG - Intergenic
1178305916 21:31489816-31489838 AACAGCCAGATGAAGTGGGATGG - Intronic
1179412925 21:41175866-41175888 GGCAGCACGATGTAGTGGGAAGG - Intronic
1179682133 21:43030051-43030073 ACCAGCCCGCTGATGTGGGCAGG - Exonic
1183987607 22:41578099-41578121 AACAAGACCATGAAGTGGGTGGG + Intronic
1184541694 22:45130070-45130092 AACAACCCCAGGAAGTGGGCAGG - Intergenic
950886425 3:16366585-16366607 AAAAGGACCATGAGGTGGGCGGG - Intronic
950930712 3:16786094-16786116 AACAAAACCAGGAAGTGGGCTGG + Intergenic
951214741 3:20013517-20013539 GACAGCAAGATGGGGTGGGCAGG - Intergenic
957587328 3:82148818-82148840 AACATCACTATGAAGTAGGCAGG - Intergenic
961170494 3:124794482-124794504 AACAGAACGAAAAGGTGGGCTGG + Intronic
966253022 3:177887928-177887950 AACAGGACCATGAACTGGGGAGG + Intergenic
968087364 3:195879865-195879887 AACAGCACGATGAAGTGGGCGGG - Intronic
985077855 4:186235579-186235601 GACAGTACGATGAGTTGGGCAGG - Intronic
985618595 5:939652-939674 AACAGGACCATGGAGTGGGCTGG - Intergenic
985866356 5:2517345-2517367 TCCAACACGATGAAGTTGGCAGG + Intergenic
986159962 5:5218734-5218756 AAGAGCAGGATGGAGTGGGAAGG + Intronic
987004901 5:13700296-13700318 AACAGCGGGATGAAGTGAGCAGG - Intronic
989125393 5:38047700-38047722 CACAACTCTATGAAGTGGGCAGG - Intergenic
990876556 5:60493040-60493062 AACAGCACAGTGAAGTGTGTTGG + Intronic
1001892235 5:175349312-175349334 AACAGCACGAGGAAGAGGCTTGG - Intergenic
1006047416 6:31308940-31308962 AAGATCAGGATGAACTGGGCTGG - Intronic
1010369270 6:75088704-75088726 AATAACAGGATGAAGTTGGCTGG + Intronic
1018210943 6:161481019-161481041 AGCAGCACGTGGAAGTGGGCAGG + Intronic
1018676062 6:166223303-166223325 AACAGCAGGAGGCACTGGGCTGG - Intergenic
1021889199 7:25171159-25171181 AACAGTACTATGCAGTGGACTGG + Intronic
1026979728 7:74519287-74519309 AACAGCCCCATGAGGAGGGCAGG - Intronic
1028007543 7:85593886-85593908 ACCAGCACAGTGAAGTGGGGGGG + Intergenic
1030104065 7:105971828-105971850 AACAACACGAAGAATTGTGCTGG - Intronic
1032076284 7:128837669-128837691 GTCTGCACGGTGAAGTGGGCAGG - Exonic
1033116779 7:138632544-138632566 AACAGAAGGATGAAGAGGGAAGG + Intronic
1034680106 7:152922127-152922149 AACAGCAAGAGGAAGAGGGAGGG + Intergenic
1038695462 8:29802422-29802444 GATAGGAGGATGAAGTGGGCAGG + Intergenic
1039516687 8:38139763-38139785 AGCAGCACGAGGAAGGGAGCTGG + Exonic
1040295852 8:46148716-46148738 AACAGCCGGGTGACGTGGGCAGG - Intergenic
1040339565 8:46433596-46433618 CACAGCAGGATGACATGGGCAGG + Intergenic
1041352651 8:56964148-56964170 AATAGCAGGATGGAGTGTGCAGG + Intronic
1052437119 9:28443787-28443809 AACAGCACGTTGATGGTGGCAGG + Intronic
1053052126 9:34970879-34970901 AACATCCCTGTGAAGTGGGCTGG + Intronic
1057296390 9:93845919-93845941 AACAGCACAAAGGAGTGGGTAGG - Intergenic
1058427147 9:104884937-104884959 TACGGTAAGATGAAGTGGGCTGG + Intronic
1059044075 9:110845245-110845267 AACAGCAAGATGAAGTTGTCAGG + Intergenic
1059450351 9:114367827-114367849 ATCAGCCCCAGGAAGTGGGCTGG + Intronic
1060185599 9:121562213-121562235 AACAGGATCATGCAGTGGGCTGG + Intergenic
1186771084 X:12818816-12818838 AACAGGAAGAGAAAGTGGGCAGG - Intronic
1189889438 X:45583910-45583932 AACAGCCCCTTGAGGTGGGCAGG + Intergenic
1191692872 X:63958964-63958986 AACAGCACCATGAGGTTGGGAGG + Intergenic
1193675608 X:84448201-84448223 AACAGCAGGATGAACTGTGTGGG + Intronic
1197729756 X:129799392-129799414 AACAACACAATCAAGTGGGAAGG + Intergenic
1199820222 X:151438177-151438199 AACAGCAGGTGGAAGTGGCCTGG + Intergenic
1200808478 Y:7457813-7457835 AATAGGAGGAGGAAGTGGGCTGG + Intergenic