ID: 968097166

View in Genome Browser
Species Human (GRCh38)
Location 3:195940231-195940253
Sequence CGGTGTAGCTGGAGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968097166_968097174 7 Left 968097166 3:195940231-195940253 CCCCCGGGTCTCCAGCTACACCG No data
Right 968097174 3:195940261-195940283 CTGGAACATCAGCTCCCCGCCGG No data
968097166_968097175 8 Left 968097166 3:195940231-195940253 CCCCCGGGTCTCCAGCTACACCG No data
Right 968097175 3:195940262-195940284 TGGAACATCAGCTCCCCGCCGGG No data
968097166_968097179 23 Left 968097166 3:195940231-195940253 CCCCCGGGTCTCCAGCTACACCG No data
Right 968097179 3:195940277-195940299 CCGCCGGGTCTCCAGCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968097166 Original CRISPR CGGTGTAGCTGGAGACCCGG GGG (reversed) Intergenic
No off target data available for this crispr