ID: 968099209

View in Genome Browser
Species Human (GRCh38)
Location 3:195954089-195954111
Sequence GGGGGAGACCGCGGGGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968099197_968099209 0 Left 968099197 3:195954066-195954088 CCCCAGGAGACCGGGCAGCGGAC No data
Right 968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG No data
968099192_968099209 21 Left 968099192 3:195954045-195954067 CCGGGCAGGAGGCAGGGGCGGCC No data
Right 968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG No data
968099198_968099209 -1 Left 968099198 3:195954067-195954089 CCCAGGAGACCGGGCAGCGGACG No data
Right 968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG No data
968099204_968099209 -10 Left 968099204 3:195954076-195954098 CCGGGCAGCGGACGGGGGAGACC No data
Right 968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG No data
968099199_968099209 -2 Left 968099199 3:195954068-195954090 CCAGGAGACCGGGCAGCGGACGG No data
Right 968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968099209 Original CRISPR GGGGGAGACCGCGGGGGACC CGG Intergenic
No off target data available for this crispr