ID: 968099279

View in Genome Browser
Species Human (GRCh38)
Location 3:195954243-195954265
Sequence GGGGGAGGCCGCTGGGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968099261_968099279 20 Left 968099261 3:195954200-195954222 CCGGGCAGGGGCGGTGGAGACGG No data
Right 968099279 3:195954243-195954265 GGGGGAGGCCGCTGGGGACCCGG No data
968099258_968099279 30 Left 968099258 3:195954190-195954212 CCGCGGGGGTCCGGGCAGGGGCG No data
Right 968099279 3:195954243-195954265 GGGGGAGGCCGCTGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968099279 Original CRISPR GGGGGAGGCCGCTGGGGACC CGG Intergenic
No off target data available for this crispr