ID: 968099292

View in Genome Browser
Species Human (GRCh38)
Location 3:195954274-195954296
Sequence GGGGGAGGCCGCGGGGCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968099287_968099292 -10 Left 968099287 3:195954261-195954283 CCCGGCAGGTGACGGGGGAGGCC No data
Right 968099292 3:195954274-195954296 GGGGGAGGCCGCGGGGCAACCGG No data
968099281_968099292 0 Left 968099281 3:195954251-195954273 CCGCTGGGGACCCGGCAGGTGAC No data
Right 968099292 3:195954274-195954296 GGGGGAGGCCGCGGGGCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968099292 Original CRISPR GGGGGAGGCCGCGGGGCAAC CGG Intergenic
No off target data available for this crispr