ID: 968100282

View in Genome Browser
Species Human (GRCh38)
Location 3:195960011-195960033
Sequence TGGGGGCCTCAGCACTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968100282_968100288 23 Left 968100282 3:195960011-195960033 CCTTCCTAGTGCTGAGGCCCCCA No data
Right 968100288 3:195960057-195960079 GTGTGTGATGTGTTGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968100282 Original CRISPR TGGGGGCCTCAGCACTAGGA AGG (reversed) Intergenic
No off target data available for this crispr