ID: 968101283

View in Genome Browser
Species Human (GRCh38)
Location 3:195967370-195967392
Sequence CAAAGTTACCAGAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968101276_968101283 3 Left 968101276 3:195967344-195967366 CCAGAAAATGGCGAGAACCCAGG No data
Right 968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG No data
968101274_968101283 30 Left 968101274 3:195967317-195967339 CCAAAGCAAGGAACAGGTCACAG No data
Right 968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968101283 Original CRISPR CAAAGTTACCAGAGGGAAAA AGG Intergenic
No off target data available for this crispr