ID: 968101482

View in Genome Browser
Species Human (GRCh38)
Location 3:195968600-195968622
Sequence ACTTAGGTATGCTGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968101473_968101482 29 Left 968101473 3:195968548-195968570 CCTTCATAGTTTTACTATCACGA No data
Right 968101482 3:195968600-195968622 ACTTAGGTATGCTGGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968101482 Original CRISPR ACTTAGGTATGCTGGGAACT GGG Intergenic
No off target data available for this crispr