ID: 968101764

View in Genome Browser
Species Human (GRCh38)
Location 3:195971077-195971099
Sequence GGAGTGGACTAACAGAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968101759_968101764 19 Left 968101759 3:195971035-195971057 CCTTGGAAGTGGGAGCTGAACAG No data
Right 968101764 3:195971077-195971099 GGAGTGGACTAACAGAGACTGGG No data
968101758_968101764 20 Left 968101758 3:195971034-195971056 CCCTTGGAAGTGGGAGCTGAACA No data
Right 968101764 3:195971077-195971099 GGAGTGGACTAACAGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968101764 Original CRISPR GGAGTGGACTAACAGAGACT GGG Intergenic
No off target data available for this crispr