ID: 968108562

View in Genome Browser
Species Human (GRCh38)
Location 3:196022433-196022455
Sequence CAGGCCCGCCTGCAGTTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968108559_968108562 3 Left 968108559 3:196022407-196022429 CCTTTTGTGGAGGGCCTGACATG No data
Right 968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG No data
968108557_968108562 9 Left 968108557 3:196022401-196022423 CCTCCACCTTTTGTGGAGGGCCT 0: 6
1: 181
2: 118
3: 50
4: 145
Right 968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG No data
968108558_968108562 6 Left 968108558 3:196022404-196022426 CCACCTTTTGTGGAGGGCCTGAC 0: 6
1: 179
2: 125
3: 57
4: 147
Right 968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968108562 Original CRISPR CAGGCCCGCCTGCAGTTATC CGG Intergenic
No off target data available for this crispr