ID: 968111913

View in Genome Browser
Species Human (GRCh38)
Location 3:196055434-196055456
Sequence GCAGATAATGAGATAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968111913 Original CRISPR GCAGATAATGAGATAGAATT GGG (reversed) Intronic
903762931 1:25711846-25711868 TCAGATCATGAGACAGAATTGGG + Intronic
904191112 1:28744647-28744669 GCAGATAATGATATATTATCTGG + Intronic
904319238 1:29685748-29685770 GCAGACACTGAGATGGAGTTGGG - Intergenic
904347910 1:29885330-29885352 GCAGATTATGAGCTACAAATGGG - Intergenic
904362924 1:29990130-29990152 GGAGATAGTTAGCTAGAATTGGG - Intergenic
904721234 1:32510428-32510450 GCAGATGCTGAGATAGAGTCAGG - Intronic
906861295 1:49362910-49362932 GCAGATAATGAAACAAATTTTGG + Intronic
908348397 1:63259641-63259663 GCAGAAAATGAGAAGGAACTGGG + Intergenic
908995952 1:70154357-70154379 CCAGATAGTGAGATAAAATGAGG + Intronic
909663507 1:78109158-78109180 GCAGAAAAGGAGAGAGACTTTGG + Intronic
910634978 1:89397725-89397747 GTAGATAATGAAACAGAATATGG - Intergenic
911167889 1:94741122-94741144 GAAGATGATGAGACAAAATTAGG + Intergenic
912193081 1:107363470-107363492 TCAGATAAGGAGATGAAATTAGG - Intronic
912686493 1:111771353-111771375 GCAAATAATGAGATTTCATTAGG + Intronic
913065371 1:115247708-115247730 GCAGACATTGAGACGGAATTTGG + Intergenic
913080472 1:115380373-115380395 GCAGCTACTGAGGCAGAATTTGG - Intergenic
913140047 1:115932163-115932185 CCAAATATTGAGATACAATTTGG - Intergenic
913582507 1:120240489-120240511 GAAGATAATGAGACAGATTAAGG - Intergenic
913625666 1:120657872-120657894 GAAGATAATGAGACAGATTAAGG + Intergenic
914564439 1:148851983-148852005 GAAGATAATGAGACAGATTAAGG - Intronic
914608387 1:149278256-149278278 GAAGATAATGAGACAGATTAAGG + Intergenic
914874535 1:151502917-151502939 GCAGATACTGAGACAAAGTTAGG + Intergenic
915080805 1:153350364-153350386 GCAGGTAAAGAGATAGACTTGGG - Intergenic
916375729 1:164151348-164151370 GCAGATACTAAGATGGAATTTGG - Intergenic
916504290 1:165413938-165413960 ACAGATAAAGAGATGGAATTGGG - Intronic
916931206 1:169579676-169579698 GCAGATAATGAGGAAGAAAAGGG - Intronic
917624160 1:176829267-176829289 GGAGAGAATGAGAGAGAATGGGG + Intronic
917643741 1:177008974-177008996 CCAGATGATGAGCTAGAAATAGG + Intronic
918336249 1:183516878-183516900 GCTGATGTTGATATAGAATTAGG + Intronic
918337490 1:183533470-183533492 GCAGATAAAAGGATAGAACTTGG - Intronic
919033084 1:192269863-192269885 GCATATATTGTGATATAATTAGG + Intergenic
920901614 1:210114828-210114850 GCAGAGAATGAGGAAGAATTGGG + Intronic
922012153 1:221599609-221599631 GGAGTTTCTGAGATAGAATTGGG + Intergenic
922140031 1:222875087-222875109 ATAGAAAATGAGAGAGAATTTGG + Intronic
1063430509 10:5984421-5984443 GCTTATAAGGAGACAGAATTTGG - Intergenic
1063441511 10:6077101-6077123 GCAGACAAGGAGATGGATTTGGG + Intergenic
1065089917 10:22221218-22221240 ACAGATAATAAGACAGAACTTGG + Intergenic
1067742978 10:48910529-48910551 GCAGAAAAAGAAATAGAATGCGG + Intronic
1068029494 10:51689623-51689645 CAAGATTATGAGAGAGAATTGGG + Intronic
1069121621 10:64576104-64576126 GCAGAAATTGAGATATAGTTGGG + Intergenic
1070457942 10:76635534-76635556 GAAGATAATGAGAGAGATTCTGG - Intergenic
1070848208 10:79541177-79541199 GCTGATAATCAGCTAGACTTTGG + Intergenic
1071276068 10:84056311-84056333 GGAGATAATGACAAAGAATTGGG - Intergenic
1072441676 10:95462441-95462463 GCAAATAATGAGATTGTGTTAGG - Intronic
1072730055 10:97840143-97840165 GCAGATACTGAGATGACATTGGG - Intergenic
1073483223 10:103799974-103799996 GAGGACAATGAGATAGAATTAGG + Intronic
1074463820 10:113664761-113664783 GAAGATAATGAGATAGGAGTGGG - Intergenic
1076042562 10:127263305-127263327 GTAGATAAAGACATAGAATATGG - Intronic
1076151867 10:128169005-128169027 GCAGAGAAGGAGCTGGAATTGGG + Intergenic
1078033183 11:7774356-7774378 GGAGATAAAGAGATAAAATTGGG - Intergenic
1078176093 11:8972174-8972196 TCAGATAATGAGATAGATTATGG + Intergenic
1078265444 11:9753017-9753039 TCATATAATGAGATGGACTTTGG + Intergenic
1079378187 11:19913187-19913209 GCTGAAAATGAGATCAAATTAGG - Intronic
1079619309 11:22534041-22534063 GCAGATAATGACAGAGTATTAGG - Intergenic
1082785724 11:57315314-57315336 GGGGACAATGAGAAAGAATTAGG - Intronic
1085768209 11:79302498-79302520 GCAGTGAATTAGATATAATTTGG - Intronic
1086231024 11:84569948-84569970 ACAGGTAATTAGTTAGAATTAGG - Intronic
1086760586 11:90625624-90625646 GGAGATAATAAAATAGAGTTTGG + Intergenic
1086835823 11:91620940-91620962 GCAAATAATGAGATAGGAAAAGG + Intergenic
1087221447 11:95550895-95550917 ACAGATTCTGAGATAGAGTTGGG + Intergenic
1087646441 11:100813589-100813611 GCAGAGAGTGAGAGTGAATTAGG + Intronic
1088099135 11:106135010-106135032 ACAGATTCTGAGATAGAAGTTGG - Intergenic
1088420721 11:109643114-109643136 TCAGATAAAGAGATAGAGATGGG - Intergenic
1089867136 11:121641982-121642004 GCAGAGACTGAGGAAGAATTGGG + Intergenic
1089953175 11:122548265-122548287 GCAGAGACTGAGGAAGAATTGGG - Intergenic
1090102871 11:123819803-123819825 GAAGATAATGAGAAACAATAGGG - Intergenic
1090634359 11:128681094-128681116 GCAGATAATGAGAGATAAGGAGG + Intergenic
1090889885 11:130914564-130914586 GCAGACAAGGAGATAGAACAAGG - Exonic
1093093882 12:14950853-14950875 GAATTTAATGAGATTGAATTAGG - Intronic
1094051481 12:26225932-26225954 GCAGATGCTGAGATGGCATTGGG - Intronic
1094568786 12:31624013-31624035 GCAGAAGATGAGAGAGAATTAGG - Intergenic
1098362690 12:69670401-69670423 GCAAATAATGAGAACGATTTAGG - Intronic
1099469202 12:83025852-83025874 CCAGATAAAGAGATACACTTGGG + Intronic
1099883539 12:88499193-88499215 GCAGATGATTAGAAAGGATTAGG - Intronic
1100183877 12:92115944-92115966 GCTGAAAATGAGATGGAGTTAGG - Intronic
1100720808 12:97355951-97355973 GAAGAAGATGAGAGAGAATTGGG - Intergenic
1100737778 12:97556587-97556609 GCAGAGAATGCTATTGAATTTGG - Intergenic
1101157320 12:101940120-101940142 GAATACAATGAGATAGAATCAGG + Intronic
1102634006 12:114306859-114306881 GCAGACACTGAGCTAGAACTGGG - Intergenic
1105272791 13:18893849-18893871 GCAGACAAGGAGATAGAACAAGG - Intergenic
1106950722 13:34880761-34880783 ACAGGAAATGAGATAGAATTGGG - Intergenic
1108329935 13:49375849-49375871 GCAGAGAAAGAGATAGAATAAGG + Intronic
1108942156 13:55969744-55969766 ACAGATAATTAGATAAAATATGG + Intergenic
1109083246 13:57934880-57934902 TGATATAATGAGATAAAATTTGG - Intergenic
1109810234 13:67503898-67503920 GCAAAGAGTGAGAAAGAATTCGG - Intergenic
1110327134 13:74229864-74229886 GAAGATAAGGAGTTAGGATTAGG - Intergenic
1112158676 13:96846323-96846345 GCAGATAATGAGTTTCATTTTGG - Intergenic
1112758128 13:102662818-102662840 ACATATAATCAGGTAGAATTGGG + Intronic
1113342539 13:109440997-109441019 GCAGATGCTGAGATGGAATTTGG + Intergenic
1114179073 14:20349935-20349957 GGAGATACTGAGAGAGAATATGG - Intronic
1114252219 14:20971295-20971317 GCAGACATTGAAATAGAATGAGG - Intergenic
1114587961 14:23832069-23832091 GCAGAAAATAAGTTAGATTTGGG + Intergenic
1115949633 14:38705568-38705590 GCAGATGTTGAGACAGAGTTTGG - Intergenic
1115999659 14:39229310-39229332 GCGGATGCTGAGATAGAGTTTGG + Intergenic
1116045409 14:39736787-39736809 AAAGAGAATGAGATTGAATTGGG + Intergenic
1116607284 14:47016951-47016973 ACAGAAAATAAGATAGAATATGG - Intronic
1116613432 14:47105877-47105899 GCAGAGGCTGAGAAAGAATTGGG - Intronic
1117810029 14:59536109-59536131 GCAGATGCTGAGATGGAATTAGG - Intronic
1118793187 14:69114851-69114873 GAAGAGAATGGGAGAGAATTGGG + Intronic
1119670239 14:76512868-76512890 GCAGATGCTGAGATGGAGTTAGG + Intergenic
1119829995 14:77693349-77693371 ACAGATAATTAGATACAATTTGG - Intronic
1121292562 14:92788602-92788624 GGAGATATTGAACTAGAATTAGG - Intergenic
1121767989 14:96503468-96503490 TCTGATAATGAGATATAATTTGG + Intronic
1124702338 15:31927084-31927106 GTAGATAAGGAGATAGGATGGGG - Intergenic
1124800206 15:32825303-32825325 GAAGATCATGAGACGGAATTTGG - Intronic
1125233962 15:37490274-37490296 TCAGATGAGGAGATAGAATTAGG + Intergenic
1126539645 15:49807852-49807874 GCAAATAATGTGATAGAATAAGG + Intergenic
1127078909 15:55356248-55356270 GCAAATCTTGAAATAGAATTGGG - Exonic
1127422857 15:58825230-58825252 GCAAATAATCAAATAGAGTTAGG + Intronic
1127912376 15:63428047-63428069 GCAGAAACTGAGCTGGAATTTGG - Intergenic
1128048177 15:64638526-64638548 GCAGTTACTGAGGGAGAATTGGG + Intronic
1128602336 15:69007802-69007824 GCAGATAATCAGAATGAGTTAGG - Intronic
1129283195 15:74502188-74502210 GGAGATGCTGAGATAGAGTTTGG + Intergenic
1130429648 15:83833667-83833689 ACTGAAAATGAGATATAATTCGG + Intronic
1132016964 15:98326553-98326575 GCAGATAATGTGAGCGAATAAGG + Intergenic
1134317806 16:13135647-13135669 GCAGATGTTGAGATACAATTTGG - Intronic
1134344168 16:13373922-13373944 GCAGATGCTGAGATGGAGTTTGG + Intergenic
1135825616 16:25725000-25725022 GAAGATAATGAAATAGAAGAGGG - Intronic
1137704502 16:50525164-50525186 GCAGATGCTGAGATGGAGTTAGG - Intergenic
1137944041 16:52716938-52716960 GCAGATGCTGAAATGGAATTTGG + Intergenic
1138244061 16:55453334-55453356 TAAGATAATGAGATAGAAATGGG + Intronic
1138766599 16:59612955-59612977 GGAGGTAATAAGAGAGAATTAGG + Intergenic
1138833339 16:60403078-60403100 TGAAATAATGAGATAAAATTAGG - Intergenic
1139174035 16:64665609-64665631 GCAGATAAAGACATTGCATTGGG - Intergenic
1139236972 16:65349983-65350005 GCAGATAATGAGATCGTATTTGG + Intergenic
1140017761 16:71205110-71205132 CCAGCCAATGAGATAGAAGTCGG + Intronic
1140379243 16:74471258-74471280 GCAGATAACCAGATAGACTCTGG - Exonic
1141217725 16:82040838-82040860 GGAAATAATGAAATAGAACTTGG + Intronic
1141375700 16:83528043-83528065 GCTGATAATGAGCCAGAAGTGGG + Intronic
1143000478 17:3791724-3791746 GCAGATAATGAATCAGAATGGGG + Intronic
1143305453 17:5942917-5942939 GCAGATAATGAGTTCGAAGGGGG + Intronic
1146493530 17:33299984-33300006 GCAGAGAATGAGTTAGAAGTTGG - Intronic
1149208688 17:54278711-54278733 GCAGAGACTGAGATAGAGTTTGG + Intergenic
1149463092 17:56849806-56849828 GAAGAAAATGAGATAGATATTGG + Intronic
1149637986 17:58185548-58185570 GCAGATAAAGAGATCTAATCAGG + Intergenic
1150239204 17:63618673-63618695 GCAGGTCATGACAAAGAATTGGG + Intergenic
1150372254 17:64649892-64649914 TCATATAATGAAATATAATTAGG - Intronic
1151166984 17:72212375-72212397 GCAGAAAATAAGAGACAATTTGG + Intergenic
1153273169 18:3343107-3343129 GCAGATATTGAGACAGAGTTTGG + Intergenic
1153463919 18:5367889-5367911 AAAGATCATGAGATAGAATAAGG - Intergenic
1153692034 18:7603571-7603593 GCAGAGAAGGAGAGAGAAATGGG - Intronic
1154464575 18:14631428-14631450 GCAGACAAGGAGATAGAACAAGG - Intergenic
1154958094 18:21279345-21279367 GCATATAATTAGATGGAATTAGG - Intronic
1155479258 18:26267888-26267910 GCAGGTTCTGAGATAAAATTTGG + Intronic
1155813828 18:30277133-30277155 GTATAAAATGAGATAGAATGTGG - Intergenic
1157470674 18:47985622-47985644 GCAGATAAAAATATAGAACTGGG + Intergenic
1158978869 18:62739024-62739046 AGAGATGATGAGTTAGAATTTGG + Intronic
1159263790 18:66052078-66052100 GGAGATGAAGAGATAGAGTTGGG - Intergenic
1159817900 18:73099839-73099861 GCAGAGAAGGAGTTGGAATTGGG - Intergenic
1159834972 18:73326354-73326376 GCAGAGGCTGAGAAAGAATTGGG - Intergenic
1160144579 18:76353143-76353165 ACAGAGAAGGAGATAGAAATGGG + Intergenic
1164082989 19:21876685-21876707 GCAAATATCCAGATAGAATTGGG + Intergenic
1167824500 19:51960155-51960177 GCAGATGCTGAGACAGTATTTGG - Intergenic
1168481155 19:56720796-56720818 GAAGAAAATGAGATGGAAATAGG - Intergenic
925224255 2:2169136-2169158 GCAGATGATGGGGTAGAATTAGG + Intronic
925666655 2:6264130-6264152 GCTGCTAAGGAGATAGAAGTGGG + Intergenic
926432525 2:12802912-12802934 GTAGATTATGGGATAGAATAAGG + Intergenic
926767506 2:16335150-16335172 GCAGATACTGAGAGGGAGTTTGG - Intergenic
927338817 2:21956736-21956758 ACAGATAATGAGAAACAAATGGG + Intergenic
928422395 2:31148787-31148809 GCAGACAGAGAGAGAGAATTCGG + Intronic
930097656 2:47578640-47578662 GTGCATAATGTGATAGAATTGGG - Intergenic
931025582 2:58110617-58110639 GCTAATACTGAGATAGAATTAGG + Intronic
931260931 2:60618553-60618575 GCGGATAATGAGAAAGTTTTGGG - Intergenic
931425165 2:62164292-62164314 GAAGAAAATGAGATAGACTTGGG + Intergenic
932440685 2:71732767-71732789 GCAAATAATGAGTTAGGTTTGGG - Intergenic
933034376 2:77374312-77374334 GCAGAAAATGCAATAAAATTAGG + Intronic
935474392 2:103500307-103500329 GAAGATAGTGAGATGGAAATGGG - Intergenic
935506243 2:103907536-103907558 GCACATAATTAGAGAGTATTTGG + Intergenic
935851664 2:107228243-107228265 GCATATAATGAGACATTATTAGG - Intergenic
936540394 2:113345187-113345209 GCACTCAATCAGATAGAATTAGG - Intergenic
936616460 2:114052882-114052904 GCAGAGAAAGAGAGAGAATGGGG - Intergenic
937901067 2:127019549-127019571 GCAGAGAATGAGATAAGATAAGG + Intergenic
938131740 2:128722005-128722027 GCAGACAATGAGAAAGAAATGGG + Intergenic
938732037 2:134154159-134154181 GCAGGTAATGAGGAGGAATTTGG + Intronic
938932900 2:136102308-136102330 GCAGATGCTGAGACAGAGTTAGG - Intergenic
939355205 2:141092680-141092702 ACAGCTAATGAGATAGAAACAGG + Intronic
939909828 2:147966684-147966706 ACAAATAATGAGGTAGAATCAGG + Intronic
940265929 2:151837806-151837828 GCAGAAAATTATAAAGAATTTGG - Exonic
942070895 2:172314284-172314306 GCAGATAATGAGAAAAGATTGGG + Intergenic
942812339 2:180013925-180013947 GCAGATACTGAGATAGAAACAGG + Intergenic
943186093 2:184609122-184609144 TCAGGTAATGAGGAAGAATTTGG + Intronic
943812851 2:192211167-192211189 TAAGAAAATGAGATAGAATAAGG - Intergenic
944442443 2:199756178-199756200 GCAGGTAATGAGAGACAATCTGG + Intergenic
944460337 2:199942380-199942402 GCAGATGCTGAGATGGAATTAGG - Intronic
944979540 2:205099996-205100018 GCAGATTATGACATTGTATTTGG + Intronic
945432585 2:209781362-209781384 GTAGAAAATCAGATAGGATTGGG - Intronic
945505577 2:210636501-210636523 CCAGATAATGTGGTAGATTTGGG + Intronic
946058569 2:216921549-216921571 GCAGATGCTGAGATGGACTTTGG - Intergenic
946608904 2:221437166-221437188 GCACTTAATGAGATAAAAATGGG + Intronic
946699564 2:222398033-222398055 GCAGATGTTGAGATGGAGTTTGG - Intergenic
947024094 2:225716952-225716974 GCAGACACTGAGACAGAATTTGG + Intergenic
947347279 2:229206026-229206048 CCAGATAATGAGACAGTAATTGG - Intronic
948090396 2:235288747-235288769 GCAGAAACTGAGACAGAATTAGG - Intergenic
948358526 2:237399952-237399974 GCTGATAATGAGATTGAGTCTGG - Intronic
948680356 2:239629764-239629786 GCAGATGGTGAAATAGAATTGGG - Intergenic
1168839182 20:898216-898238 GCAGATGCTGAGGAAGAATTGGG - Intronic
1168908433 20:1425581-1425603 GAAGACAATGAAATAGAAATGGG - Intergenic
1169807679 20:9576283-9576305 GCAGTTAAAGATATAGATTTTGG - Intronic
1169891129 20:10453263-10453285 GGAGAATATGAGATTGAATTAGG - Intronic
1170043063 20:12058672-12058694 GTAGATAAGGATAGAGAATTAGG + Intergenic
1170680528 20:18521646-18521668 GCAGAGGCTGAGAAAGAATTGGG + Intronic
1171108334 20:22457400-22457422 ACAGACACTGAGATAGAATTGGG + Intergenic
1173081617 20:39873964-39873986 GCAGATAATCAGAAAGAACTTGG + Intergenic
1174049209 20:47755942-47755964 AAAGATACTGAGATAGAAATGGG - Intronic
1176265988 20:64209587-64209609 GCAGATAAGGAGAGAGAACTGGG + Intronic
1176809965 21:13526956-13526978 GCAGACAAGGAGATAGAACAAGG + Intergenic
1177084500 21:16686303-16686325 CCACATAATTAGATTGAATTGGG - Intergenic
1177404097 21:20643557-20643579 GCAAATTCTGAGATAGAATTTGG - Intergenic
1177515353 21:22143584-22143606 ACTGAGAATGAGATAGAAATAGG + Intergenic
1179065943 21:38025018-38025040 GGAGATAATGAGATCAATTTAGG - Intronic
1179122488 21:38560611-38560633 GCAGATGTTGAGACGGAATTAGG - Intronic
1181298523 22:21861841-21861863 CCAAATAATGGGATGGAATTGGG - Intronic
1182951551 22:34380976-34380998 ACTAATAATGAAATAGAATTTGG - Intergenic
1182966318 22:34524944-34524966 GCAGATAAAGATATATATTTAGG - Intergenic
1184323071 22:43757807-43757829 GCAGACACTGAGATGGAGTTTGG - Intronic
1184575442 22:45361180-45361202 GAGGGTAAGGAGATAGAATTTGG - Intronic
1184808663 22:46813624-46813646 GCAGATAATACGGTAGAACTAGG + Intronic
949606520 3:5659803-5659825 GCAGATGCTGAGACAGAGTTGGG + Intergenic
949675258 3:6446119-6446141 GCAGAAATTTAGATATAATTTGG - Intergenic
950925996 3:16742656-16742678 GGAGAGAATGGAATAGAATTAGG - Intergenic
951106060 3:18744449-18744471 GCAGAAAATGATAGAGAGTTGGG + Intergenic
951390814 3:22101304-22101326 GTAGATAGAGAGATAGAAGTAGG + Intronic
954913040 3:54124108-54124130 GCAGATAAGGAGAATGAATGTGG + Intronic
955068644 3:55554126-55554148 GCATATACTGAGGTAGAATGCGG + Intronic
956137735 3:66115587-66115609 GCAGTTAATCTGATTGAATTAGG - Intergenic
956246685 3:67191317-67191339 GCATATAATCATATAAAATTTGG + Intergenic
958628677 3:96659523-96659545 GCAAATACTGAGGTAGATTTTGG - Intergenic
958935242 3:100249668-100249690 GCAGATGGTGAGATAGAGTTAGG - Intergenic
958948708 3:100394090-100394112 AAAGAAAATGAGCTAGAATTAGG + Intronic
959020094 3:101179549-101179571 GTATAAAATGAGATAAAATTGGG + Intergenic
959524582 3:107362196-107362218 GCAGACATTGAGACAGAGTTGGG - Intergenic
960336622 3:116425545-116425567 GCAGAGAATGTGATATACTTGGG + Intronic
960374992 3:116889851-116889873 GCAGATATTGAGAGAGCATAGGG - Intronic
960874235 3:122281043-122281065 GCAAAGAATGAGATAGAAGCAGG + Intronic
960901387 3:122557734-122557756 GCAGAATTTGAGATGGAATTAGG - Intronic
961479550 3:127171197-127171219 GCAGACACTGAGATGGAATGAGG + Intergenic
961970692 3:130963060-130963082 GCAGATCAAGAAATAGTATTTGG + Intronic
963431405 3:145209677-145209699 TTAGATAATGAGATAGTAATTGG - Intergenic
963861691 3:150317174-150317196 CCAAATAATGAAATAGAATAGGG - Intergenic
964467291 3:157008545-157008567 GGAGAGAAGGAGATGGAATTGGG - Intronic
967412632 3:189181974-189181996 GCAGACAAAGAAAGAGAATTTGG + Intronic
967899193 3:194430523-194430545 GCCGATAATGTGACAGAAATAGG - Intronic
968111913 3:196055434-196055456 GCAGATAATGAGATAGAATTGGG - Intronic
968242471 3:197102975-197102997 TCAGATAATGTGACAGTATTTGG - Intronic
968720568 4:2200279-2200301 GCCAATAATCAGAGAGAATTAGG + Intronic
970331223 4:14986392-14986414 GCAGATAAGGAGATTGAAACTGG - Intergenic
970367409 4:15373762-15373784 CCAGGAAATGAGATAGAATATGG - Intronic
970712851 4:18884386-18884408 CCATATAATGATATAGCATTTGG + Intergenic
971371862 4:26026344-26026366 GCAGATCATGAAAGATAATTAGG + Intergenic
971951484 4:33355074-33355096 GCAGTTAATGAGATAAATTAGGG - Intergenic
972211507 4:36843370-36843392 GCAGATGCTGAGATAGAGTTAGG - Intergenic
973221978 4:47737059-47737081 GCAGAAAATAAAATAAAATTTGG + Intronic
974027084 4:56742697-56742719 GAAGAAAAGGAGATAGATTTTGG - Intergenic
975242977 4:72083736-72083758 GAAGATAATGAGATCAATTTGGG - Intronic
975713288 4:77181619-77181641 GCAGATGCTAAGATGGAATTAGG + Intronic
975977248 4:80113359-80113381 CCAGATTCTGAGATGGAATTAGG + Intronic
977051781 4:92137405-92137427 GAAGATAATGAGAACAAATTTGG - Intergenic
978232041 4:106411378-106411400 TCAGAAAATGAGACAGCATTGGG - Intergenic
978435417 4:108678747-108678769 GCACATAAAGAGTTAGATTTTGG - Intergenic
978897845 4:113911162-113911184 GCAAAAAGTGAGAGAGAATTTGG + Intronic
979521028 4:121666498-121666520 GCAGATGCTGAGATGGAGTTAGG - Intergenic
979731195 4:124024513-124024535 GCAGATCCTGAGATGGGATTAGG + Intergenic
980474202 4:133290530-133290552 GGAGATAATTGGATATAATTGGG - Intergenic
983057215 4:163112382-163112404 GCAAATACTGAGATGGAAATTGG + Intronic
984428261 4:179615358-179615380 GGAGATACTGAGATAGAATCTGG + Intergenic
986039785 5:3981768-3981790 GAAGATCATGAGATAAAATCAGG - Intergenic
986937725 5:12911741-12911763 GCAGATAATAAGATTACATTAGG + Intergenic
988620406 5:32816977-32816999 GCAGATTATGAGGTAGATCTTGG + Intergenic
989795494 5:45466038-45466060 GCAAATATTAAGGTAGAATTTGG - Intronic
990766556 5:59190158-59190180 GCAGAAGATGAGATGGATTTGGG + Intronic
991130152 5:63113135-63113157 GCTTAGAAGGAGATAGAATTTGG - Intergenic
991602236 5:68365033-68365055 GCAGATATTCAGAGAGATTTGGG - Intergenic
992814647 5:80424205-80424227 GCATATATTGAAAAAGAATTTGG - Intronic
993195313 5:84734880-84734902 GGAGAAAATGAGATAACATTGGG - Intergenic
993942782 5:94080856-94080878 GCAGATGCTGAGACAGAATTTGG - Intronic
993995438 5:94717096-94717118 GCACATATTAAGATAGATTTTGG - Intronic
994607544 5:101988416-101988438 GCTCATTATGAGATAGAGTTGGG + Intergenic
995787618 5:115846998-115847020 GCAGAGAAAGAGAAAGAAATTGG - Intronic
996617706 5:125460871-125460893 GGAGATAGTGATCTAGAATTGGG + Intergenic
996863476 5:128090896-128090918 GCAGATCATGATAAAGACTTAGG + Intronic
997110066 5:131065249-131065271 GTAGATGCTGAGATAGAGTTTGG + Intergenic
997945716 5:138199224-138199246 ACAGATAATGGGATACAATAGGG + Intronic
999538051 5:152540104-152540126 GAACATAATGATTTAGAATTGGG + Intergenic
1001103330 5:168832148-168832170 GTAGATGATGAAACAGAATTGGG - Intronic
1003297880 6:4849907-4849929 GCAGGGAAGGGGATAGAATTGGG + Intronic
1004542152 6:16561277-16561299 GCAGTTAATCAGATAGTTTTAGG - Intronic
1004813733 6:19289182-19289204 ACAGATATTGTGGTAGAATTAGG - Intergenic
1005978853 6:30820587-30820609 ACAGATACTGAGATAAAGTTGGG - Intergenic
1007030952 6:38625751-38625773 GCAGAACCTGAGATAGAATAAGG + Intronic
1007817245 6:44533310-44533332 GCAGATGCTGAGATGGAGTTTGG + Intergenic
1008503072 6:52202397-52202419 GGAGATAATGAGGAAGACTTGGG - Intergenic
1008691866 6:53987947-53987969 GCAGATACTAAGATAGATTTTGG - Intronic
1009359275 6:62793181-62793203 GCAGAGACTGAGGAAGAATTGGG - Intergenic
1009768723 6:68117786-68117808 GCAGATAGTGAGATAAAATCTGG + Intergenic
1010368676 6:75082146-75082168 GCATATACTGACATAGAACTAGG + Intergenic
1010789068 6:80043499-80043521 GCAGATAAAGAGATAAACTGTGG - Intergenic
1010994776 6:82520548-82520570 GGAGATGTTGAGATAGAATGAGG + Intergenic
1012145676 6:95678434-95678456 GCAGTTGTTGAGATAGAGTTAGG - Intergenic
1013874551 6:114807795-114807817 GTAGACAATATGATAGAATTAGG + Intergenic
1014108311 6:117591972-117591994 AAAGATAATGAGATAAGATTAGG - Intronic
1014348041 6:120300519-120300541 ACAGAAGATGACATAGAATTAGG - Intergenic
1015094961 6:129404523-129404545 TCAAATAATGTGATAGAACTTGG - Intronic
1015405803 6:132835733-132835755 GCAGACAGTCAGATTGAATTAGG - Intergenic
1016506144 6:144781679-144781701 GCAAAAAATGAGATAAGATTGGG + Intronic
1016986245 6:149897890-149897912 GCAGATAATGAAGTAAAAGTGGG - Intronic
1017947103 6:159104623-159104645 ACAGATAATGAGAAAGACTAGGG - Intergenic
1018848986 6:167574259-167574281 ACACAAAATGAGATAGAAATTGG + Intergenic
1018863173 6:167726964-167726986 GGAGATAAGGAGACAGAAATAGG + Intergenic
1019951274 7:4375045-4375067 GCAAATATTGAGACAGGATTTGG + Intergenic
1021163374 7:17303281-17303303 TCAGATAATGAGAAAGAGTTTGG + Intronic
1021581641 7:22160452-22160474 GCAGCAAATATGATAGAATTTGG - Intronic
1021944760 7:25715857-25715879 GTAGATCATGAGACAGATTTGGG - Intergenic
1024555434 7:50599510-50599532 GCAGATAATGGGATTGATTCAGG - Intronic
1026104968 7:67413635-67413657 GCAGATGCTAAGATGGAATTTGG + Intergenic
1027731329 7:81877212-81877234 GTAGATCATGAGATACCATTAGG + Intergenic
1027851864 7:83461370-83461392 GCAGAGGCTGAGGTAGAATTGGG - Intronic
1028965167 7:96793989-96794011 GAAGATAATGAGTTTGATTTGGG + Intergenic
1029317015 7:99724596-99724618 GCAGAGGATGAGGAAGAATTGGG - Intronic
1030319541 7:108150221-108150243 GCAAATTATGAGAAAGCATTTGG + Intronic
1030583685 7:111390380-111390402 GCAGACATTGAGATGGAGTTTGG - Intronic
1031308683 7:120166132-120166154 GCAGATAAGGAGAAAGAAAAGGG - Intergenic
1031525513 7:122818622-122818644 GCAGATGCTGAGGAAGAATTGGG - Intronic
1031610908 7:123826214-123826236 TCTGATAATGAGATAGAGATAGG + Intergenic
1031687566 7:124749801-124749823 GCAGATAAAGAGGCACAATTGGG + Intronic
1031728010 7:125262911-125262933 GCAGAGGATGAGGAAGAATTGGG + Intergenic
1031777257 7:125919280-125919302 GCAGAGGATGAGGAAGAATTGGG - Intergenic
1038117401 8:24572908-24572930 GCAGACAGCAAGATAGAATTAGG - Intergenic
1040825661 8:51618206-51618228 GCAGAGAATGGGACAGAAATAGG + Intronic
1042165667 8:65943469-65943491 GAAGATCAGGAGATAGCATTAGG - Intergenic
1044139547 8:88633564-88633586 GCAGATAATGTGCAATAATTTGG + Intergenic
1044622902 8:94208032-94208054 TCAGAGAATGAGATTCAATTTGG - Intronic
1045227009 8:100258261-100258283 GCACATACTTAGATAGAAATTGG - Exonic
1045883544 8:107069310-107069332 GCAGACACTGAGATGGAGTTTGG + Intergenic
1045896714 8:107227056-107227078 GTAAATAATGAAAGAGAATTAGG - Intergenic
1046163836 8:110402742-110402764 GCAGAAAATGAGAACTAATTAGG - Intergenic
1046438479 8:114227315-114227337 ACAGATTAAGAGAAAGAATTTGG - Intergenic
1046611702 8:116432795-116432817 GAAGACAATGAGATAAAATAAGG + Intergenic
1046681601 8:117176874-117176896 GAAGATAATGTGTTAGAATCAGG + Intergenic
1047198583 8:122744100-122744122 GAAGAAGATGAGATTGAATTTGG + Intergenic
1048383537 8:133889974-133889996 GGAGTTAATGAGATAGTGTTTGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1050025926 9:1334556-1334578 GCAGATAAAGACACAGAAATGGG - Intergenic
1050044217 9:1526676-1526698 GCAGACACTGAGATGGAGTTTGG + Intergenic
1050173830 9:2850009-2850031 GCAGATGTCAAGATAGAATTAGG + Intergenic
1050258767 9:3819227-3819249 GCAGACACTGAGACAGAGTTGGG - Intergenic
1050320432 9:4446811-4446833 TCACATCATGAGAAAGAATTTGG - Intergenic
1050676251 9:8057468-8057490 GCAGACAGTGAGATGCAATTTGG - Intergenic
1050895987 9:10886430-10886452 GCAGAGGCTGAGAAAGAATTGGG - Intergenic
1051256289 9:15217097-15217119 GCAGAGAATGAGAGAAAATGAGG + Intronic
1052340696 9:27361683-27361705 ACAGATAAAGAAATAGATTTGGG + Intronic
1052642184 9:31182472-31182494 GCACATAATGAAATATTATTGGG + Intergenic
1053548180 9:39045807-39045829 GCAGATAAAGAGATAAAATGTGG - Intergenic
1053812301 9:41865845-41865867 GCAGATAAAGAGATAAAATGCGG - Intergenic
1054618294 9:67321594-67321616 GCAGATAAAGAGATAAAATGCGG + Intergenic
1054739511 9:68790539-68790561 GCAGATAATGTCAAATAATTGGG + Intronic
1056362427 9:85872434-85872456 GCAGACACTGAGATGGAATTTGG + Intergenic
1056363616 9:85882357-85882379 GCAGAGGTTGAGAAAGAATTGGG - Intergenic
1057864557 9:98668671-98668693 GCAGAGAAGGAGGGAGAATTGGG - Intronic
1058116141 9:101086224-101086246 GCAGATATTAGGCTAGAATTTGG + Intronic
1058546385 9:106064473-106064495 AAAGAAAAAGAGATAGAATTTGG - Intergenic
1059373043 9:113858794-113858816 TCAAATAATGAGCAAGAATTTGG - Intergenic
1060270493 9:122137070-122137092 GCAGAAATTCAGATCGAATTTGG + Intergenic
1186820266 X:13280897-13280919 GCAGAGGATGAGTTAGAATAAGG - Intergenic
1187008764 X:15258198-15258220 ACAAATAATGTGATAGAACTTGG + Intronic
1187092513 X:16111867-16111889 GCAGAAACTGAATTAGAATTAGG + Intergenic
1187976061 X:24706577-24706599 GCAGATACAAATATAGAATTGGG - Intronic
1188267210 X:28092235-28092257 GCAAACAATAAGATAAAATTGGG - Intergenic
1189056671 X:37706533-37706555 GCAGATAAAGAGATTGAGGTTGG + Intronic
1189672518 X:43426042-43426064 GCAGATGTTGAAATGGAATTAGG - Intergenic
1189689252 X:43598897-43598919 GCAGATGCTGTGATAGAATTTGG + Intergenic
1190571076 X:51782230-51782252 GCAGATAATGAGACAGAGTTAGG - Intergenic
1190903906 X:54707352-54707374 GCAAATAATTAGAAAGCATTTGG + Intergenic
1191912022 X:66161414-66161436 GCAGGGAAGGAGATAGAAATGGG - Intergenic
1192459140 X:71302383-71302405 ATAGATAAGGAGATAGGATTAGG - Intronic
1194039078 X:88917456-88917478 GCAAATAATGAGCTAGAAAGAGG + Intergenic
1194935931 X:99948900-99948922 GCAGAGAATGAGGTAGAAGTGGG + Intergenic
1195877519 X:109557664-109557686 GCATATATTGTGATAGAGTTAGG - Intergenic
1196410687 X:115414966-115414988 ACAGATGATGAAACAGAATTGGG - Intergenic
1196420782 X:115518988-115519010 GCAGATGTTGAGGTAGAATGTGG - Intergenic
1196476666 X:116094369-116094391 GCATACAATGGGATATAATTTGG - Intergenic
1197291484 X:124664180-124664202 CAAGATATTGAGGTAGAATTGGG - Intronic
1197391446 X:125871651-125871673 GGAAATAATGAAAAAGAATTAGG - Intergenic
1197444494 X:126533567-126533589 GCAGGCAAGGAGATAGAATCAGG + Intergenic
1197524977 X:127549522-127549544 GCAGAAAAGGAGTTAGAATCAGG - Intergenic
1198178040 X:134174306-134174328 GAAGATAATGAGATTTATTTGGG - Intergenic
1198185791 X:134253267-134253289 GAAGATACTGAGATGGAATTTGG + Intergenic
1199064328 X:143396637-143396659 GCAGAGAATGAGAAAGGGTTTGG - Intergenic
1199133367 X:144221023-144221045 GCAAATAATGACATAATATTAGG + Intergenic
1200427777 Y:3040380-3040402 GCAGATACTGTGATGGAATTAGG + Intergenic
1201481071 Y:14440184-14440206 GCAGACAATGAGATAGCAGAGGG + Intergenic