ID: 968114796

View in Genome Browser
Species Human (GRCh38)
Location 3:196081567-196081589
Sequence AGGTGCAGCTGCGCGGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968114796_968114800 -2 Left 968114796 3:196081567-196081589 CCGCACGCCGCGCAGCTGCACCT 0: 1
1: 0
2: 0
3: 7
4: 140
Right 968114800 3:196081588-196081610 CTTGGCTGCGCCCGCGCTCCCGG 0: 1
1: 0
2: 1
3: 9
4: 127
968114796_968114803 11 Left 968114796 3:196081567-196081589 CCGCACGCCGCGCAGCTGCACCT 0: 1
1: 0
2: 0
3: 7
4: 140
Right 968114803 3:196081601-196081623 GCGCTCCCGGACCCGCAGCCCGG 0: 1
1: 0
2: 2
3: 16
4: 159
968114796_968114809 26 Left 968114796 3:196081567-196081589 CCGCACGCCGCGCAGCTGCACCT 0: 1
1: 0
2: 0
3: 7
4: 140
Right 968114809 3:196081616-196081638 CAGCCCGGAGCCGGCGCACTAGG 0: 1
1: 0
2: 0
3: 7
4: 197
968114796_968114806 17 Left 968114796 3:196081567-196081589 CCGCACGCCGCGCAGCTGCACCT 0: 1
1: 0
2: 0
3: 7
4: 140
Right 968114806 3:196081607-196081629 CCGGACCCGCAGCCCGGAGCCGG 0: 1
1: 0
2: 3
3: 24
4: 200
968114796_968114810 27 Left 968114796 3:196081567-196081589 CCGCACGCCGCGCAGCTGCACCT 0: 1
1: 0
2: 0
3: 7
4: 140
Right 968114810 3:196081617-196081639 AGCCCGGAGCCGGCGCACTAGGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968114796 Original CRISPR AGGTGCAGCTGCGCGGCGTG CGG (reversed) Intronic
900630810 1:3634196-3634218 AGGAGGAGCTGCGCGGTGTCTGG - Intronic
901162629 1:7191680-7191702 TGGTACAGCTGCAAGGCGTGAGG + Intronic
906203514 1:43974935-43974957 AGGTGACGCTGCGGGGCGGGCGG + Exonic
906536959 1:46556377-46556399 AGTTGCAGCTGGGCAGGGTGTGG + Intergenic
906640727 1:47439067-47439089 AGGCGCGGCGGCGCGGCCTGGGG - Exonic
915366680 1:155320865-155320887 GGGTGCAGCTGCGCAGCGCAGGG + Intergenic
920372707 1:205489677-205489699 AGGTGCAGCTGCAGGACTTGGGG - Intergenic
922615408 1:226958366-226958388 AGCTGCCGCTGCCCAGCGTGTGG - Intronic
924567399 1:245210185-245210207 AGCTGCAGCTGCGGGGCCTTGGG - Intronic
1070896085 10:79983635-79983657 AGGTGGAGCTGCGCGCAATGTGG - Intergenic
1073426406 10:103458076-103458098 AGGTGGAGCTCCGAGGTGTGGGG - Intronic
1076046232 10:127296324-127296346 AGGTGCAGCTCCACTACGTGAGG - Intronic
1076371488 10:129958919-129958941 ATGTGCAGGTGAGCGGCGGGCGG - Exonic
1076756868 10:132577142-132577164 AGGTGCAGCGGCCCTGCCTGGGG - Intronic
1076809556 10:132879543-132879565 TGGAGCAGCTGCGTAGCGTGCGG - Exonic
1077017383 11:403063-403085 AGGGGCAGCTGCGCAGGGCGGGG - Exonic
1077113177 11:870802-870824 AGCAGCCGCTGCGCGGCCTGAGG - Intronic
1077482251 11:2821258-2821280 AGGTGCAGAGGCCCCGCGTGGGG + Intronic
1078315297 11:10289281-10289303 AGCTGCAGCTGTGTGGGGTGGGG + Intronic
1078801222 11:14644955-14644977 AGGTCCAGCTGCGTGTCGTTAGG + Exonic
1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG + Intergenic
1087822854 11:102731174-102731196 AGGAGCAGGTGTGCGGTGTGAGG - Intergenic
1089209494 11:116790764-116790786 AGGAGCAGTTGCGCGTGGTGGGG - Exonic
1089291785 11:117441701-117441723 AGGTTCAGGTGCATGGCGTGGGG + Intronic
1089507186 11:118971819-118971841 AGGCGCGGCGGCGCGGAGTGGGG - Exonic
1089555756 11:119315322-119315344 AGCTGCAGCAGCGCTGCGAGGGG - Intronic
1091225788 11:133956012-133956034 AGGTGCGGCTGAGAGGCGCGGGG + Intronic
1091780121 12:3208389-3208411 AGGTGCAGCTGCAGGCCTTGGGG - Intronic
1091795132 12:3293755-3293777 AGTTGCAGCTGGGCAGCCTGAGG + Intergenic
1093336604 12:17912512-17912534 AGTGGCAGCTGTGAGGCGTGTGG + Intergenic
1096812760 12:54182285-54182307 AGGTGCAGCTGCTGGGGGTGCGG - Exonic
1097279989 12:57839164-57839186 AGGTGAAGCTGAGGGGTGTGGGG - Intronic
1097882380 12:64698123-64698145 AGGTGCAGGTGCGCAGAGGGTGG - Intergenic
1102959850 12:117085390-117085412 AGGTGCAGCCGCCCAGGGTGAGG + Intronic
1104237180 12:126950438-126950460 AGGTGCAGCTGGGTCACGTGGGG + Intergenic
1104355888 12:128086936-128086958 AGGGGCAGCGGCGGGGCGGGGGG + Intergenic
1104850080 12:131868574-131868596 AGGAGCAGGTGCGCTGGGTGTGG + Intergenic
1105029034 12:132869769-132869791 AGGTGCAGGTGCAGGGCGAGGGG - Exonic
1107412640 13:40172222-40172244 AGGGGGAGCTGCGCGGGGTGAGG + Intergenic
1108029222 13:46211766-46211788 AGGGGAAGCTGCGGGCCGTGGGG - Intronic
1113437804 13:110307049-110307071 AGGGACGGCTGCCCGGCGTGCGG + Exonic
1115851140 14:37591621-37591643 AGGTGCAGCTGGGACTCGTGGGG + Exonic
1117157851 14:52958455-52958477 AGGTGCAGCAGGGTGGGGTGGGG - Intergenic
1121352526 14:93184884-93184906 CGGGGAAGCTGCGCGGCGGGCGG + Exonic
1122059205 14:99125303-99125325 GGGTGCAGCTGGGAGCCGTGGGG + Intergenic
1122694707 14:103547000-103547022 AGGGGCAGGTGCGTGGCGTTTGG + Intergenic
1122797089 14:104211427-104211449 AGGTGCTGCTGGGCAGCGAGTGG - Intergenic
1122816477 14:104316538-104316560 AGGTGCAGGCGGGCGCCGTGAGG + Intergenic
1125514124 15:40308408-40308430 AGGTGCACCTGCCGGGCGGGCGG + Intergenic
1130353825 15:83112490-83112512 AGGTGCAGCAGGGTGGGGTGAGG + Intronic
1132398468 15:101490331-101490353 GGGTTCACCTGCGCGGCCTGGGG - Intronic
1132398475 15:101490352-101490374 GGGTTCACCTGCGCGGCCTGGGG - Intronic
1132398489 15:101490394-101490416 GGGTTCACCTGCGCGGCCTGGGG - Intronic
1132756569 16:1488157-1488179 TGGTGCAGCTGCATGGCCTGGGG - Intronic
1133464639 16:6018543-6018565 AGGCCCAGCTGTGCGGGGTGGGG + Intergenic
1134065274 16:11224456-11224478 GGTGGCAGCTGTGCGGCGTGTGG - Intergenic
1134509343 16:14833910-14833932 TGCTGCTGCTGAGCGGCGTGGGG + Exonic
1134697048 16:16232725-16232747 TGCTGCTGCTGAGCGGCGTGGGG + Exonic
1134974795 16:18561960-18561982 TGCTGCTGCTGAGCGGCGTGGGG - Exonic
1136749382 16:32619389-32619411 AGGTGCTGCTGTGAGGCATGTGG + Intergenic
1138105585 16:54285797-54285819 ATGGGCAGCTCCGCGGCGTAGGG + Exonic
1140110293 16:71998350-71998372 AGGTGCAGCTGAGGGGCTTTGGG + Exonic
1141456275 16:84144768-84144790 GGGTGCAGCGCCGCGGCGGGGGG + Intronic
1142199638 16:88754948-88754970 AGGTTCAGCTGCTGGGCCTGGGG - Intronic
1142221524 16:88857182-88857204 AGGTGCGTACGCGCGGCGTGGGG + Exonic
1142365842 16:89649231-89649253 AGGTGGATCAGCGCGGGGTGGGG - Intronic
1142367503 16:89657774-89657796 GGGCGCGGCTGCGCGGCGCGCGG + Exonic
1203051514 16_KI270728v1_random:878603-878625 AGGTGCTGCTGTGAGGCATGTGG + Intergenic
1144675431 17:17158626-17158648 AGGAGCGGGTGGGCGGCGTGGGG + Exonic
1144781281 17:17809789-17809811 AGGTGAAGCTGGACGGGGTGGGG + Intronic
1144782158 17:17813753-17813775 AGGAACAGCTGCACGGCCTGGGG + Exonic
1145398047 17:22511605-22511627 CAGTGCAGCTGCGGGGTGTGGGG + Intergenic
1146398748 17:32487599-32487621 TGGTGCTGCTGCGCGCCGGGCGG - Exonic
1151682925 17:75631144-75631166 AGATGCAGCTGCGCAAGGTGAGG - Exonic
1152764453 17:82128448-82128470 AAGTGCAGCTGTGTGGGGTGTGG - Intronic
1154492578 18:14933180-14933202 AGGTGCATCTGTGGGGAGTGGGG + Intergenic
1157306287 18:46519974-46519996 AGCTGCAGCTGCACTGCGTGGGG + Intronic
1157785080 18:50474371-50474393 AGGTGCAGGTGCAAGGAGTGGGG - Intergenic
1160949245 19:1657820-1657842 AGGTGCAGAGGGGCTGCGTGGGG - Intergenic
1163272012 19:16260101-16260123 AGCTGCAGCTGCCTGGGGTGGGG - Intergenic
1163398019 19:17075517-17075539 AGGGGTGGCTGCGAGGCGTGAGG + Exonic
1166072159 19:40394029-40394051 GGGTGCGGCTGCCCAGCGTGGGG - Exonic
1166831785 19:45643691-45643713 AGGGCCAGCTGCGCGGCCTGTGG - Intronic
1168643168 19:58043131-58043153 AGGTGGAGCTGCTCTGCGCGGGG + Intronic
925388481 2:3479821-3479843 ACGTGCAGGTGCACGGCGAGAGG - Intronic
926123380 2:10256664-10256686 AGAGGCAGCTGCCTGGCGTGTGG + Intergenic
929030852 2:37648881-37648903 AGGAGCAGCTGGGTGGCCTGAGG + Intronic
929981416 2:46683738-46683760 AGGTGCAGAGGCGGGGCATGAGG - Intergenic
933655155 2:84880967-84880989 GGGCGCAGCTTCGCGGCGCGGGG - Exonic
935133431 2:100278418-100278440 ATGAGCAGCTGCACGGCCTGTGG - Exonic
948722538 2:239910684-239910706 GGGTACAGGTGCGGGGCGTGTGG - Intronic
948803296 2:240442355-240442377 AGCTGCAGCTGCTCAGCCTGTGG - Intronic
1168756778 20:324187-324209 AGGTGCGGCTCCGCGGCGCGGGG - Intergenic
1168757230 20:325926-325948 TGGTGCAGCAGCGGGGCGCGAGG + Exonic
1169130669 20:3164991-3165013 AGGAGCAGCTGCTCAGCCTGCGG - Exonic
1169321196 20:4634596-4634618 AGGTGCAGCTCTGCTGGGTGAGG - Intergenic
1169342598 20:4807869-4807891 AGGTGCAGATGCCCAGAGTGGGG - Intronic
1175127733 20:56764899-56764921 CAGTGCAGCTACGGGGCGTGTGG + Intergenic
1176145603 20:63564029-63564051 AGGTGCAGCCGCGTGTCGGGGGG + Exonic
1176423212 21:6532716-6532738 AGGTGCAGCTGCTCCAGGTGTGG + Intergenic
1178705289 21:34868007-34868029 AGCTGCAGCTGGGAGGCCTGAGG + Intronic
1179494090 21:41760746-41760768 AGGAGCAGCTGGGGGGTGTGGGG + Intronic
1179643521 21:42761902-42761924 AGGGGCAGCTGAGCGGCAGGAGG + Intronic
1179698705 21:43141032-43141054 AGGTGCAGCTGCTCCAGGTGTGG + Intergenic
1180086484 21:45510049-45510071 AGGTGGAGCTGCGGGGAGAGGGG - Exonic
1180243059 21:46524671-46524693 AGGTGCAGCTGCTCTGCCTAGGG - Intronic
1180784035 22:18537044-18537066 AGCTGGAGCTGGGCGGAGTGGGG - Intergenic
1181127604 22:20711092-20711114 AGCTGGAGCTGGGCGGAGTGGGG - Intronic
1181240936 22:21476396-21476418 AGCTGGAGCTGGGCGGAGTGGGG - Intergenic
1181568181 22:23752154-23752176 AGGTGCAGCTGCCCAGCTTGTGG + Intergenic
1181748697 22:24973986-24974008 AGGTGCAGCTGGGCAGAGGGTGG - Intronic
956097784 3:65735640-65735662 AGGTGCTGCTGTGGGGCCTGGGG - Intronic
967762426 3:193241105-193241127 AGGTGCAGTTCCCCGGCGGGCGG + Exonic
968114796 3:196081567-196081589 AGGTGCAGCTGCGCGGCGTGCGG - Intronic
968382417 4:107829-107851 AGGGGCGGGTCCGCGGCGTGCGG + Intergenic
969626195 4:8306860-8306882 ACGTGGAGCTGCGGGGTGTGAGG + Exonic
972321696 4:37977830-37977852 AGCGGCAGCTCCGCGGCGCGGGG - Intronic
992549110 5:77844769-77844791 GGTCGCTGCTGCGCGGCGTGGGG + Intronic
997608122 5:135191333-135191355 AGGAGCTGCTTCGCGGCTTGCGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1002334493 5:178468581-178468603 AGGGGAAGCTGCTCTGCGTGTGG - Intronic
1004525941 6:16407996-16408018 AGGTGCATCTGCTAGGCATGCGG + Intronic
1005856840 6:29869185-29869207 AGGTGCAGCTGAGCAGCTGGGGG + Intergenic
1007473845 6:42106667-42106689 AGGTGCAGCTGGGGGAAGTGGGG + Exonic
1018876505 6:167826804-167826826 AGGTGCGGCGGCGCCGCGCGGGG + Intergenic
1026936983 7:74263187-74263209 AGAGGCAGCTGCCCGACGTGGGG - Intergenic
1027318704 7:76999297-76999319 AGGTGCAGCTGTGCGCCCTCAGG + Intergenic
1032015982 7:128380726-128380748 AGGAGCAGCTGAGGGGCCTGTGG + Intergenic
1034436435 7:151064760-151064782 CGGTGCAGGTGCGCTGGGTGCGG + Exonic
1035761560 8:2072477-2072499 GGGTGCAGCCGCGCGCCGAGTGG + Exonic
1037699509 8:21262055-21262077 AGGTGCAGCTGAGAGCTGTGTGG - Intergenic
1037835890 8:22214516-22214538 AGGGGCAGCTGCACTGGGTGGGG - Intergenic
1038640474 8:29320614-29320636 AGTTCCAGCTGAGCGGGGTGGGG - Intergenic
1040942158 8:52844759-52844781 AGGTCCAGCTGCCCTGCCTGAGG - Intergenic
1042104681 8:65313889-65313911 AGGGGCAGCAGTGGGGCGTGGGG - Intergenic
1044591249 8:93916652-93916674 AGGTGTGGCTGCGCGGCGCTAGG - Intronic
1049381899 8:142320369-142320391 AGGTGCAGGAGGGCGGTGTGGGG - Intronic
1049423556 8:142527227-142527249 AGGGGAAGCTGCGGGGCGTGGGG + Intronic
1060916758 9:127396710-127396732 AGGTGCAGCTTCTCGGAGTTGGG + Intergenic
1060967851 9:127721492-127721514 AGGAGCAGGTGGGCGGGGTGGGG + Intronic
1186515204 X:10161684-10161706 AGTTGCAGCTGCCAGGGGTGGGG - Intronic
1187181389 X:16946708-16946730 CGCGGCAGCTGCGGGGCGTGGGG + Exonic
1192509881 X:71715453-71715475 AGGTGGAGATGTGCGGAGTGCGG + Intronic
1192516816 X:71766100-71766122 AGGTGGAGATGTGCGGAGTGCGG - Intronic
1194240047 X:91434739-91434761 AAGGGCAGATGCGCGGCGGGCGG - Intronic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic
1198782301 X:140250509-140250531 AGCAGCAGCTGCCCGACGTGTGG - Intergenic
1201175847 Y:11307889-11307911 AGGTGGAGCGGCCCGGCTTGTGG - Intergenic