ID: 968124126

View in Genome Browser
Species Human (GRCh38)
Location 3:196145929-196145951
Sequence CCTCTGTGGCCACTACCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968124126_968124134 -3 Left 968124126 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG No data
Right 968124134 3:196145949-196145971 AGGAGCTGCTGGTTTGGGTGGGG No data
968124126_968124133 -4 Left 968124126 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG No data
Right 968124133 3:196145948-196145970 GAGGAGCTGCTGGTTTGGGTGGG No data
968124126_968124130 -9 Left 968124126 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG No data
Right 968124130 3:196145943-196145965 CCACAGAGGAGCTGCTGGTTTGG No data
968124126_968124132 -5 Left 968124126 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG No data
Right 968124132 3:196145947-196145969 AGAGGAGCTGCTGGTTTGGGTGG No data
968124126_968124135 5 Left 968124126 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG No data
Right 968124135 3:196145957-196145979 CTGGTTTGGGTGGGGCCTTCCGG No data
968124126_968124131 -8 Left 968124126 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG No data
Right 968124131 3:196145944-196145966 CACAGAGGAGCTGCTGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968124126 Original CRISPR CCTCTGTGGCCACTACCCAG AGG (reversed) Intergenic
No off target data available for this crispr