ID: 968124309

View in Genome Browser
Species Human (GRCh38)
Location 3:196147135-196147157
Sequence TCTGAACCCCACTGGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968124309_968124314 11 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124314 3:196147169-196147191 CATCCTGGCAGCACAGTTTATGG No data
968124309_968124317 15 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124317 3:196147173-196147195 CTGGCAGCACAGTTTATGGGAGG No data
968124309_968124319 27 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124319 3:196147185-196147207 TTTATGGGAGGCAGGAAAAGAGG No data
968124309_968124321 29 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124321 3:196147187-196147209 TATGGGAGGCAGGAAAAGAGGGG No data
968124309_968124318 19 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124318 3:196147177-196147199 CAGCACAGTTTATGGGAGGCAGG No data
968124309_968124322 30 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124322 3:196147188-196147210 ATGGGAGGCAGGAAAAGAGGGGG No data
968124309_968124315 12 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124315 3:196147170-196147192 ATCCTGGCAGCACAGTTTATGGG No data
968124309_968124320 28 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124320 3:196147186-196147208 TTATGGGAGGCAGGAAAAGAGGG No data
968124309_968124313 -4 Left 968124309 3:196147135-196147157 CCTGCGCCCCAGTGGGGTTCAGA No data
Right 968124313 3:196147154-196147176 CAGAAGCTCATACAGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968124309 Original CRISPR TCTGAACCCCACTGGGGCGC AGG (reversed) Intergenic
No off target data available for this crispr