ID: 968125991

View in Genome Browser
Species Human (GRCh38)
Location 3:196160658-196160680
Sequence TGTTTTTTCTTTTAATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2341
Summary {0: 1, 1: 2, 2: 17, 3: 231, 4: 2090}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968125991_968125996 12 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90
968125991_968126001 23 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968126001 3:196160704-196160726 TAAATCAGCTGGGGCAGGGTTGG 0: 1
1: 0
2: 1
3: 25
4: 309
968125991_968125998 14 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125998 3:196160695-196160717 GATCAGGAGTAAATCAGCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 116
968125991_968126000 19 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968126000 3:196160700-196160722 GGAGTAAATCAGCTGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 182
968125991_968125997 13 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125997 3:196160694-196160716 TGATCAGGAGTAAATCAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
968125991_968125993 -2 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125993 3:196160679-196160701 CAAATAATTTCCCAGTGATCAGG 0: 1
1: 0
2: 0
3: 11
4: 174
968125991_968125999 18 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125999 3:196160699-196160721 AGGAGTAAATCAGCTGGGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968125991 Original CRISPR TGTTTTTTCTTTTAATCTCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr