ID: 968125992

View in Genome Browser
Species Human (GRCh38)
Location 3:196160659-196160681
Sequence TTGTTTTTTCTTTTAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3036
Summary {0: 1, 1: 2, 2: 45, 3: 330, 4: 2658}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968125992_968126000 18 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968126000 3:196160700-196160722 GGAGTAAATCAGCTGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 182
968125992_968125999 17 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125999 3:196160699-196160721 AGGAGTAAATCAGCTGGGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 269
968125992_968125996 11 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90
968125992_968125998 13 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125998 3:196160695-196160717 GATCAGGAGTAAATCAGCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 116
968125992_968125997 12 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125997 3:196160694-196160716 TGATCAGGAGTAAATCAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
968125992_968126001 22 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968126001 3:196160704-196160726 TAAATCAGCTGGGGCAGGGTTGG 0: 1
1: 0
2: 1
3: 25
4: 309
968125992_968125993 -3 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125993 3:196160679-196160701 CAAATAATTTCCCAGTGATCAGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968125992 Original CRISPR TTGTTTTTTCTTTTAATCTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr