ID: 968125996

View in Genome Browser
Species Human (GRCh38)
Location 3:196160693-196160715
Sequence GTGATCAGGAGTAAATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968125991_968125996 12 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90
968125992_968125996 11 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968125996 Original CRISPR GTGATCAGGAGTAAATCAGC TGG Intergenic
904752819 1:32751573-32751595 GTGATCAGTACTATATCAGAAGG + Intronic
907389590 1:54149583-54149605 GTTTTCAGGTGTAAATCAGGTGG - Intronic
911341277 1:96641812-96641834 CTAATAAGAAGTAAATCAGCAGG - Intergenic
915718523 1:157966377-157966399 GACCTCAGCAGTAAATCAGCAGG - Intergenic
915897557 1:159823635-159823657 GTGCACAGGAGTAAATTAGCTGG - Intergenic
922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG + Intronic
923464264 1:234234295-234234317 GTTATCAGGAGGCAATCAGATGG + Intronic
923816233 1:237382161-237382183 CTGATCAGTAGAAAATCAGTTGG - Intronic
1063226190 10:4017065-4017087 ATGATCAGCAGTAACTCACCTGG - Intergenic
1063258220 10:4352893-4352915 GTGTTCAGGAGGAAAAGAGCTGG + Intergenic
1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG + Intergenic
1066539011 10:36423969-36423991 CTGATAAGTAGTAAATCAGCGGG - Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1074007918 10:109447047-109447069 CAGATGAGGAGTAAATAAGCTGG - Intergenic
1074538090 10:114343323-114343345 GTGATCACGAGGAAAGCAGGAGG - Intronic
1074710283 10:116171821-116171843 GTGAGCAGGAGTGACTCAGTAGG - Intronic
1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG + Intergenic
1077320887 11:1941402-1941424 GAGGTCAGGAGTTGATCAGCTGG - Intergenic
1083912106 11:65716072-65716094 GTGTGCAGAAGTAAAGCAGCAGG + Intronic
1084318393 11:68359146-68359168 GTGATGAGGAGTGGATTAGCTGG + Intronic
1085656281 11:78318204-78318226 GGGATCAGGAGTGAATCTGGTGG + Intronic
1087366308 11:97224067-97224089 GGCTTCAGGAGTAAATCACCTGG - Intergenic
1089776809 11:120843397-120843419 GGGAGAAGGAGTACATCAGCAGG + Intronic
1093603903 12:21065952-21065974 ATGGTCAGGAGAAAATCACCAGG - Intronic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1102174330 12:110865082-110865104 GTAAGCAGGACTAAACCAGCTGG - Intronic
1103890176 12:124232543-124232565 GTCACCAGCAGTAATTCAGCAGG + Intronic
1107109247 13:36677832-36677854 GTGACCAGGATTATATCAGAGGG + Intronic
1118314671 14:64718608-64718630 ATGATCAGGAGCAAGTCAGCGGG - Intronic
1120223692 14:81766058-81766080 GTGGTCAAGATTAAATCAGATGG - Intergenic
1128605827 15:69036003-69036025 GGGCTCTGGAGTAAATCAGAGGG - Intronic
1138173079 16:54871276-54871298 GTGATCATGAGTGAATTATCGGG - Intergenic
1140773234 16:78225642-78225664 CTCATCTGGAGAAAATCAGCTGG - Intronic
1141852168 16:86653883-86653905 GGGACCAGGAGGAAACCAGCAGG - Intergenic
1146188522 17:30744695-30744717 GTGGTCAGGAGAAAAGAAGCAGG - Intergenic
1146333395 17:31949008-31949030 GTGGTCAGGAGAAAAGAAGCAGG - Intronic
1147425817 17:40345424-40345446 GAGATCAGCAGGAAATCAGCCGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149465431 17:56875034-56875056 GTAATCAGGATTAAATAAGGTGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG + Intergenic
1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG + Intronic
1159170812 18:64763956-64763978 AGGATCAGGAGTACATCCGCAGG - Intergenic
1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG + Intronic
1163702698 19:18794130-18794152 GTTATCTGGAGAATATCAGCAGG - Intergenic
926291520 2:11534939-11534961 GTGCTCAGGACAGAATCAGCTGG + Intronic
930182731 2:48380426-48380448 GTGCCCAGAAGTAAATCTGCTGG - Intergenic
936828074 2:116605587-116605609 GCAATGAGGGGTAAATCAGCAGG - Intergenic
940457226 2:153915838-153915860 TTGATGAGGGGTAAATCACCTGG - Intronic
942938975 2:181594035-181594057 GTGATAAGGATTAAATGAGTTGG + Intronic
947714633 2:232333428-232333450 GTGCTCAGCAGTGACTCAGCAGG + Intronic
1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG + Intergenic
1182290481 22:29274559-29274581 GGGAACAGGGGAAAATCAGCTGG - Intronic
1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG + Intronic
950195349 3:11005610-11005632 GTGATGAGGAGGAAAACAGGAGG - Intronic
960118208 3:113919178-113919200 GTGAAAAGGAGTAAAGTAGCGGG + Intronic
960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG + Exonic
961769838 3:129241004-129241026 GTGATCTGGAGTGCAGCAGCAGG + Intergenic
962629553 3:137262587-137262609 ATGATCAGGAGTAAATACACAGG + Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG + Intronic
971715722 4:30173856-30173878 TTGATCATGAATAAATCATCTGG - Intergenic
973698878 4:53517443-53517465 ATGATCAGGACTCAATTAGCAGG - Intronic
981922507 4:150100502-150100524 GGGATAAGTAGTAAGTCAGCTGG - Intronic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
983657220 4:170095296-170095318 GGGATGAGGAGTCAATCTGCTGG + Intergenic
983672732 4:170256983-170257005 GTTAGCATGAGTACATCAGCTGG + Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
992369380 5:76127156-76127178 GTGATGAGGAGTAAAGCAAAGGG + Intronic
999321285 5:150616677-150616699 GAGATCAGGAATAAATGAGAAGG - Intronic
999745799 5:154590810-154590832 GAGAACAGGAGTAAAACACCTGG - Intergenic
999883635 5:155895069-155895091 GTGATCAGAAGTAAGTCTACAGG - Intronic
1002803000 6:544137-544159 GAAATAAGGAGTAAAACAGCTGG - Intronic
1002995599 6:2281099-2281121 AGGATCAAGAGTAAATCAGGAGG - Intergenic
1007311977 6:40954012-40954034 TTGATCAGAAGTACATGAGCTGG + Intergenic
1008471384 6:51889101-51889123 GTGATCAGGATTGAATCATGTGG - Intronic
1013461130 6:110376508-110376530 GGGAGCATGAGTAATTCAGCTGG + Intergenic
1016610549 6:145984164-145984186 GAAATAAGGAGTACATCAGCAGG + Intergenic
1022038919 7:26560826-26560848 ATGATTAGGAGCAAAACAGCAGG + Intergenic
1024936835 7:54719490-54719512 GTGGCCAGGAGGAAATCAGTTGG - Intergenic
1032272733 7:130425631-130425653 GTGCTCAGGAGTACAACTGCTGG - Intronic
1032707022 7:134429931-134429953 GTGGTGAGGAGTAAATGAGCTGG - Intergenic
1035961634 8:4144640-4144662 TTTATCAGGAGATAATCAGCAGG + Intronic
1037059317 8:14486732-14486754 GAGCCCAGGAGTAAATTAGCTGG - Intronic
1037187262 8:16079114-16079136 GTAATCAAGATTAAATGAGCAGG + Intergenic
1045229731 8:100292021-100292043 GTGATCAGTAGAAACTCTGCTGG - Intronic
1047309314 8:123678215-123678237 GTGATCTTGAGTAAATGACCTGG + Intergenic
1050819503 9:9859808-9859830 GTTATAAGGAGAAAGTCAGCTGG - Intronic
1058777699 9:108301139-108301161 GTGACCAGGAGGAAATCATGAGG + Intergenic
1059802291 9:117762718-117762740 GTGGTCTGGAGTAAAGAAGCAGG + Intergenic
1061667015 9:132166467-132166489 GGGATAAGGAGAAAATCCGCAGG - Exonic
1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG + Intronic
1187581752 X:20614640-20614662 GGGATCAGGAGTGAAGGAGCAGG - Intergenic
1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG + Intergenic
1198279655 X:135129115-135129137 GTCATCATGAGAAAATCACCTGG + Intergenic
1198291302 X:135243399-135243421 GTCATCATGAGAAAATCACCTGG - Intergenic
1198708936 X:139480246-139480268 GTCAACAGGACTGAATCAGCAGG - Intergenic