ID: 968125996

View in Genome Browser
Species Human (GRCh38)
Location 3:196160693-196160715
Sequence GTGATCAGGAGTAAATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968125991_968125996 12 Left 968125991 3:196160658-196160680 CCCAGAGATTAAAAGAAAAAACA 0: 1
1: 2
2: 17
3: 231
4: 2090
Right 968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90
968125992_968125996 11 Left 968125992 3:196160659-196160681 CCAGAGATTAAAAGAAAAAACAA 0: 1
1: 2
2: 45
3: 330
4: 2658
Right 968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968125996 Original CRISPR GTGATCAGGAGTAAATCAGC TGG Intergenic