ID: 968128486

View in Genome Browser
Species Human (GRCh38)
Location 3:196177600-196177622
Sequence ACAGAGGTGCTCAAGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968128481_968128486 -1 Left 968128481 3:196177578-196177600 CCCGTTTGCAGACACCGTCTTTA No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data
968128477_968128486 21 Left 968128477 3:196177556-196177578 CCCTAATACTTTAAGCCGTGACC No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data
968128478_968128486 20 Left 968128478 3:196177557-196177579 CCTAATACTTTAAGCCGTGACCC No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data
968128480_968128486 0 Left 968128480 3:196177577-196177599 CCCCGTTTGCAGACACCGTCTTT No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data
968128479_968128486 6 Left 968128479 3:196177571-196177593 CCGTGACCCCGTTTGCAGACACC No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data
968128476_968128486 22 Left 968128476 3:196177555-196177577 CCCCTAATACTTTAAGCCGTGAC No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data
968128482_968128486 -2 Left 968128482 3:196177579-196177601 CCGTTTGCAGACACCGTCTTTAC No data
Right 968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968128486 Original CRISPR ACAGAGGTGCTCAAGGTGAG AGG Intergenic
No off target data available for this crispr