ID: 968134474

View in Genome Browser
Species Human (GRCh38)
Location 3:196211199-196211221
Sequence GACCAGCAGCACCACATTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968134471_968134474 20 Left 968134471 3:196211156-196211178 CCTGGAAAACTCACGGGAATGCG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 968134474 3:196211199-196211221 GACCAGCAGCACCACATTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968134474 Original CRISPR GACCAGCAGCACCACATTGA AGG Exonic
900975638 1:6014597-6014619 GGCAAGCAGCACCACAGAGAGGG + Intronic
901441500 1:9281078-9281100 GACCCGCAGCACCACTTGGTGGG + Intergenic
903836095 1:26204089-26204111 GACCATCAGCAGCACAGAGAAGG + Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
904991637 1:34598081-34598103 GAGCAGCAGCACCCCCTAGAGGG + Intergenic
905673764 1:39810721-39810743 TTCCAGCAGCCCCATATTGAAGG - Intergenic
905829731 1:41055788-41055810 GACAAGAAGAACCACATTGAAGG + Intronic
909466173 1:75976616-75976638 GCACAGCAGCACCGCACTGAAGG + Intergenic
921608390 1:217181660-217181682 GACCAGAAACACCCCAATGAGGG - Intergenic
922453819 1:225758147-225758169 CACCTGCAGCAGCACATGGACGG + Intergenic
924454211 1:244205258-244205280 TAGCAGCAGCACCAAATTTAAGG - Intergenic
924541436 1:244984464-244984486 AACCAGGAGTAGCACATTGATGG + Intronic
1068996429 10:63210969-63210991 CACCAGCATCACCACATTTGAGG - Intronic
1074692103 10:116015583-116015605 TACCAAGAGCACCAAATTGAAGG - Intergenic
1080831842 11:35901553-35901575 GACTAACAGAGCCACATTGAAGG + Intergenic
1084118795 11:67056952-67056974 GCCCACCAGGACCACCTTGACGG - Exonic
1087623274 11:100566683-100566705 GACCAGCAGCCCCATAGTGAAGG - Intergenic
1088176695 11:107060608-107060630 GAACAGCAGCAAGCCATTGATGG - Intergenic
1096556256 12:52405969-52405991 GACCAGCAGGCTCTCATTGATGG + Exonic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101500249 12:105297809-105297831 TCCCAGCAGAACCACATTGAAGG + Intronic
1102354305 12:112219955-112219977 GCCCAGCATCACAACAATGAGGG + Intronic
1103695106 12:122808863-122808885 GAGCATCAGCACCACACTGATGG - Intronic
1109432883 13:62258675-62258697 CAGCAGGGGCACCACATTGAAGG + Intergenic
1111398930 13:87706521-87706543 GACCAGCAGAACCTGAATGAAGG - Intergenic
1113437443 13:110304382-110304404 GACAAGCATCACCACACTGAGGG + Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1120599279 14:86480987-86481009 GACAAGCAAAACCACATAGAAGG - Intergenic
1122796179 14:104207340-104207362 GACCAGCTGTACCACGTGGATGG - Intergenic
1124041653 15:26111002-26111024 GACCAGGAACACCTCCTTGAAGG - Intergenic
1129663081 15:77564140-77564162 GACCACCAGCCCCACACGGAGGG - Intergenic
1130605531 15:85313132-85313154 GAGAGGTAGCACCACATTGAGGG - Intergenic
1130705856 15:86232332-86232354 GAACAGCACCACCACATGGCCGG - Intronic
1131735206 15:95324855-95324877 GGCCAGCAGCGCCACATTTCTGG - Intergenic
1132887506 16:2189143-2189165 GAGCAGCTGGACCACCTTGAAGG + Exonic
1134071235 16:11261140-11261162 CAACAGCATCACCACAGTGAGGG - Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1143642230 17:8205583-8205605 GCCCAGCAACTCCACACTGAAGG + Intronic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1147340564 17:39751164-39751186 GACCAGCAGCAGCCCATTCTTGG + Intergenic
1152177374 17:78796708-78796730 GCCCAGCAGAGCCACACTGAAGG + Exonic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156227720 18:35125567-35125589 GAACACCTGCACCACACTGAAGG + Intronic
1156922112 18:42534432-42534454 GACCAGCAGCACCCAACAGAAGG - Intergenic
1159643685 18:70892349-70892371 GGCCAGCAGCACCAGAAAGAGGG + Intergenic
1163732195 19:18955577-18955599 GCCCAGCAGCACCAGTGTGAGGG + Intergenic
1163739751 19:19004219-19004241 GATCAGCAGCAAGTCATTGAAGG - Exonic
1166225363 19:41391859-41391881 AACCTGCAGCACCACGGTGATGG + Exonic
1166751161 19:45164567-45164589 GACAAGCAGCATCACACTGGGGG + Intronic
1167235519 19:48312265-48312287 GCCCACCAGAACCACATGGAGGG - Intronic
927515245 2:23668452-23668474 GAACAGGTGCACCACATTGGAGG + Intronic
937936850 2:127252666-127252688 GAACAACATAACCACATTGAAGG + Intergenic
938344404 2:130556958-130556980 GACCAGCAGCAGGACACAGAGGG - Intergenic
938345429 2:130563764-130563786 GACCAGCAGCAGGACACAGAGGG + Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
940753790 2:157658852-157658874 GACCAGCAGCATCAGACTGAAGG - Intergenic
941600916 2:167543758-167543780 GACACGAAGCACCACATTCAAGG - Intergenic
942434289 2:175954833-175954855 CACCAGCATAAGCACATTGAAGG + Intronic
946984387 2:225255930-225255952 GAGCAACAGCAGCCCATTGAAGG + Intergenic
947818973 2:233057668-233057690 GCTCAGCATCACCACATGGATGG - Intergenic
948090619 2:235291584-235291606 GAATAGCACCACCACACTGAAGG + Intergenic
1168867804 20:1104092-1104114 AACCAGTAGCCCCACATTTATGG - Intergenic
1168876537 20:1175923-1175945 GACCAGCAGGCCCAGATGGAGGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1172848653 20:37944974-37944996 CACCAGCAGGACCCCTTTGAGGG + Exonic
1177002526 21:15632261-15632283 TACCAGGAACACCACATTCATGG - Intergenic
1178969376 21:37158184-37158206 TACCAGCAGCAGCAAACTGATGG - Intronic
1180092569 21:45540505-45540527 GACCAGCAGCAGCCCCTTGCTGG - Intronic
1181290459 22:21788693-21788715 GACCAGCTGAACCACATTTTGGG - Exonic
1183904437 22:41029783-41029805 GACCAGCAGCTTCAAAGTGATGG + Intergenic
1184529439 22:45045231-45045253 AACCAGAAGAACCACATTGATGG - Intergenic
950682015 3:14592114-14592136 ATCCAGCAGCTCCACATAGAGGG + Intergenic
950796455 3:15514310-15514332 GACCAGCAGCATCACACTCTTGG + Intronic
953906183 3:46869323-46869345 GACCAGAAGCCCCACCTAGACGG + Intronic
953999123 3:47542361-47542383 GACCAGCAGGAGCACACTGCAGG - Intergenic
957767383 3:84643620-84643642 TACCAGTATCACCACATTAAAGG + Intergenic
961376388 3:126468861-126468883 GACCAGCAACAGCACAGTGGGGG - Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964429919 3:156594580-156594602 GACCAGCTGCACGACACGGAGGG - Intergenic
965659609 3:171027670-171027692 AACAAGCAGCAACACAATGAGGG + Intergenic
967341295 3:188401320-188401342 GACCAGCGGCACCAAAATGAGGG - Intronic
968134474 3:196211199-196211221 GACCAGCAGCACCACATTGAAGG + Exonic
969232242 4:5839852-5839874 GCCCAGCTCCACCACATTGTCGG + Intronic
973708459 4:53602487-53602509 GACCAGGAGCTGCACCTTGAAGG + Intronic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
988436066 5:31177018-31177040 GACCAGCAGCAACACAGCCATGG - Intergenic
988974102 5:36498201-36498223 GACAACCAGCCACACATTGAGGG + Intergenic
992595189 5:78339417-78339439 GACAAACTGGACCACATTGAGGG + Intergenic
994737591 5:103574629-103574651 CACAAGAAGTACCACATTGATGG - Intergenic
995962820 5:117864343-117864365 GACCAACAACATCACAATGAAGG - Intergenic
996954714 5:129169092-129169114 GCCCAGAAGCACCTCAGTGATGG - Intergenic
997634054 5:135391488-135391510 GACAAGGAGCACCACTTTTAAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1001833628 5:174811274-174811296 GACCACCACCACCAAATGGAGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1004860212 6:19796340-19796362 CACCACCACCACCACACTGATGG + Intergenic
1015879018 6:137852292-137852314 GAAGATCAGCATCACATTGATGG - Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018236700 6:161732953-161732975 GAGCAACAGCACCATAATGAGGG + Intronic
1020484499 7:8704794-8704816 GACTTGCATCACCACAGTGAAGG + Intronic
1020993324 7:15230176-15230198 TACCAGCAGCAGCATATTGGTGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023734130 7:43219942-43219964 CCCCAGCAGCACCACACTGGAGG - Intronic
1030584250 7:111397573-111397595 TACCAGCAACACAATATTGATGG - Intronic
1030903310 7:115150840-115150862 TAACAGCAGCACCACATAAAAGG - Intergenic
1031013488 7:116548117-116548139 GACCAGCTGCATCAAAATGAGGG + Intronic
1032270748 7:130402650-130402672 TACCAGCAGTGCCACATTGTTGG - Exonic
1033686824 7:143647602-143647624 GACCAGCAGCAGCTCCTGGAGGG - Intronic
1033688910 7:143719705-143719727 GACCAGCAGCAGCTCCTGGAGGG + Exonic
1033697787 7:143810012-143810034 GACCAGCAGCAGCTCCTGGAGGG + Intergenic
1034636077 7:152568212-152568234 CAGCAGCAGCAGCACTTTGAAGG + Intergenic
1038244158 8:25838835-25838857 GACCAGAAGGACCAGAATGAAGG + Intergenic
1039439007 8:37581722-37581744 GACCAGCATCCCCACAGAGAAGG + Intergenic
1044146782 8:88725578-88725600 AAGCTGCAGCAACACATTGAAGG - Intergenic
1044717805 8:95116643-95116665 GCCCAGCCTAACCACATTGAAGG + Intergenic
1047928844 8:129706470-129706492 GCCGAGCAGCACCAGTTTGAGGG + Intergenic
1048870552 8:138793692-138793714 TACCTGCAGCATCACATTCAAGG - Intronic
1049211075 8:141386675-141386697 GCCCTGCAGCACCCCATTCAGGG - Intergenic
1055534741 9:77228764-77228786 GACCAACAGCTCCACATGGCTGG + Intronic
1056645211 9:88405771-88405793 CACCAGCATCACCACAAAGACGG + Intronic
1061546870 9:131309533-131309555 GTCCATCAGCATCACAGTGAGGG - Intergenic
1062148078 9:135001720-135001742 GACCAGCAGCTCAACTCTGAGGG - Intergenic
1194382006 X:93204944-93204966 CACCACCAGCACCACGTTCACGG + Intergenic
1195221045 X:102745791-102745813 GACCACCACCACCACATTTCTGG - Intronic
1195656184 X:107333557-107333579 TCCCAGCATCACCACATTGCTGG - Intergenic
1196747017 X:119080177-119080199 GACAAGAAGCAAAACATTGATGG + Exonic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic