ID: 968137010

View in Genome Browser
Species Human (GRCh38)
Location 3:196227053-196227075
Sequence GGCAAAGGGTGTTCTTGTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968137010_968137020 22 Left 968137010 3:196227053-196227075 CCTGTACAAGAACACCCTTTGCC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 968137020 3:196227098-196227120 CTGGAAGAGCTCGGCACCCACGG 0: 1
1: 0
2: 2
3: 14
4: 159
968137010_968137013 -9 Left 968137010 3:196227053-196227075 CCTGTACAAGAACACCCTTTGCC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 968137013 3:196227067-196227089 CCCTTTGCCCCATCAAGAGGCGG 0: 1
1: 0
2: 7
3: 27
4: 162
968137010_968137021 27 Left 968137010 3:196227053-196227075 CCTGTACAAGAACACCCTTTGCC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 968137021 3:196227103-196227125 AGAGCTCGGCACCCACGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 70
968137010_968137019 13 Left 968137010 3:196227053-196227075 CCTGTACAAGAACACCCTTTGCC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 968137019 3:196227089-196227111 GACTCTGCTCTGGAAGAGCTCGG 0: 1
1: 0
2: 1
3: 18
4: 244
968137010_968137018 3 Left 968137010 3:196227053-196227075 CCTGTACAAGAACACCCTTTGCC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 968137018 3:196227079-196227101 TCAAGAGGCGGACTCTGCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968137010 Original CRISPR GGCAAAGGGTGTTCTTGTAC AGG (reversed) Exonic
903741711 1:25562328-25562350 TGCAAAGGCTGTTCTTCTCCAGG - Intronic
904487507 1:30836910-30836932 GGCAAAGGATGTTGGTGTTCGGG - Intergenic
904666791 1:32128661-32128683 GGCAGAGGCTCTTCTTCTACTGG - Intronic
909063571 1:70906056-70906078 GGCAAAGAGAGAGCTTGTACAGG - Intronic
909351406 1:74657392-74657414 GGCAAAGAGTTTTCTTATATAGG - Intronic
909597072 1:77418253-77418275 GGCAAAGGGAGAACTTGTCCAGG + Intronic
913613680 1:120534055-120534077 GGCAAAGGGAGTAGTTGTAAAGG - Intergenic
914576587 1:148976826-148976848 GGCAAAGGGAGTAGTTGTAAAGG + Intronic
915601535 1:156925592-156925614 GGGAAAGGGTGTACTTGTATGGG + Intronic
921822814 1:219637083-219637105 AGGAAAGTGTGTTCATGTACTGG - Intergenic
923461360 1:234212046-234212068 GGCAAAGAGAGTGCTTGTGCAGG - Intronic
1063122203 10:3113091-3113113 GGAAAAGGGTGTCGTTGGACCGG - Intronic
1067946272 10:50691235-50691257 AGTACAGGGTGTTCTTGTCCAGG + Intergenic
1069205025 10:65670769-65670791 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
1070881588 10:79856236-79856258 AGTACAGGGTGTTCTTGTCCAGG + Intergenic
1071122187 10:82291364-82291386 GACATATGGTGTTCATGTACTGG + Intronic
1071648162 10:87372550-87372572 AGTACAGGGTGTTCTTGTCCAGG + Intergenic
1072654438 10:97320180-97320202 GGCGAAGGGGGTTCATGCACCGG - Exonic
1074401860 10:113148068-113148090 ATCAAAGGGTGTTCTGGAACAGG - Intronic
1074828277 10:117230272-117230294 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
1075077736 10:119362293-119362315 GGCAAAGGGTGATCCTAAACTGG - Intronic
1075187297 10:120274560-120274582 GCCAAAGAGTGTTCTGGAACAGG - Intergenic
1079021524 11:16913028-16913050 GGCCAAGGCTGTTCTGGTAGAGG + Intronic
1079519534 11:21309742-21309764 GGCAAAGAGAGAGCTTGTACAGG + Intronic
1085141044 11:74142022-74142044 GGCAGAGGGTGTTTTTGTGGGGG - Intronic
1086794134 11:91079431-91079453 TGCAAACGGTGTTCCTGTTCCGG - Intergenic
1089586866 11:119515133-119515155 GGCAAAGGGTGGTTTTGTCGGGG + Intergenic
1095402270 12:41828308-41828330 GGCAAAATGTGTTATTGTACTGG + Intergenic
1095840197 12:46684436-46684458 GGCAAAGGCAGAACTTGTACAGG + Intergenic
1096457156 12:51797108-51797130 GGCAAGGGGTGGACTTGTAATGG - Intronic
1096984669 12:55748537-55748559 AGCAAAGGGTGTTTGTGTAGGGG - Intronic
1102966294 12:117130302-117130324 GGCAAAGGGTGTCCTGTCACAGG + Intergenic
1104645012 12:130491018-130491040 GGAAAATGGTGTTCTTATTCCGG + Intronic
1111803347 13:93006474-93006496 GGCAAAGGGAGAACTTGTGCAGG - Intergenic
1116359073 14:43970381-43970403 GGCAAAAGGTATCCTTGTAAAGG - Intergenic
1117256640 14:53984963-53984985 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
1118070758 14:62244705-62244727 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
1118795245 14:69137702-69137724 GGCAAAGGGGCTTACTGTACTGG - Intronic
1119157205 14:72422092-72422114 GGCAAAGGGAGAGCTTGTGCAGG - Intronic
1119887664 14:78156746-78156768 GGCCAAGGCTTTTCTTGTGCTGG - Intergenic
1121694529 14:95901953-95901975 GGCAAAGTGTGTTCCAGTAGAGG + Intergenic
1121874094 14:97435071-97435093 GGGGAAGGGTGTTCTGGTCCTGG - Intergenic
1125785405 15:42312419-42312441 GGCAAAGAGAGTGCTTGTGCAGG - Intronic
1128242708 15:66111955-66111977 AGTAAAGGGTGATCTTGAACCGG + Intronic
1130365615 15:83235581-83235603 GGCAAAGGAGGTTATTGTATTGG + Intergenic
1130917508 15:88317582-88317604 TGCAACGTGTGTTCTTGGACGGG + Intergenic
1131076666 15:89499511-89499533 GGCAAACGGCCTTCTTGTGCTGG - Intergenic
1131492430 15:92874616-92874638 TGCAAAGGCTGGTCTTGAACTGG + Intergenic
1133220614 16:4317685-4317707 GGCAAAGGGTGTCCTGGGAGGGG - Intronic
1138857519 16:60712456-60712478 GGCAAGGTGTGATCTTGTTCAGG + Intergenic
1139181519 16:64753857-64753879 GGGAAAGGGTGTTATTGTAGAGG + Intergenic
1140813481 16:78600082-78600104 GGCAAAGAGTGAGCTTGTGCAGG + Intronic
1141008547 16:80375874-80375896 GGCAAGGGGTCTTCTGGCACAGG - Intergenic
1153136727 18:1926000-1926022 GGCAAAGCATGTCTTTGTACTGG + Intergenic
1154404357 18:14075049-14075071 GGCAAAGAGAGAGCTTGTACAGG + Intronic
1158566702 18:58560231-58560253 GGCAAAGGGAGTGCTTCTGCAGG - Intronic
1159062226 18:63527988-63528010 GGCAAAGAGTGAGCTTGTGCAGG - Intergenic
1160292422 18:77606936-77606958 GGCAAAGGGTCTAATTGTCCAGG + Intergenic
1163647931 19:18500698-18500720 GGCAGAGGGTGGTCTTGGGCTGG + Intronic
1164491848 19:28721998-28722020 GACAAAGGGTCTGTTTGTACAGG + Intergenic
1166259124 19:41625862-41625884 GGGAAAGGATGTTCTTCTACTGG - Exonic
1166646478 19:44535578-44535600 GGCAAAGAGAGAGCTTGTACAGG + Intergenic
925243592 2:2358322-2358344 GGCAAAAGGGGATATTGTACTGG + Intergenic
925499902 2:4490898-4490920 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
929376021 2:41288305-41288327 GGCAAAGAGAGAGCTTGTACAGG + Intergenic
932399687 2:71471403-71471425 GGCACAGGGTGTTTATCTACAGG + Intronic
932707351 2:74037016-74037038 GGCAGAGGGTATTCTTATATGGG - Intronic
934050193 2:88203716-88203738 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
935018680 2:99209708-99209730 GTCAAAGGGAGTTCTTCAACCGG - Intronic
935445489 2:103151910-103151932 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
936890564 2:117365506-117365528 GGCAAAGGGAGAGCTTGTGCAGG + Intergenic
941678137 2:168366096-168366118 GGCAGAGCGTGTCCTTGCACAGG + Intergenic
944294542 2:198047671-198047693 GGAAAAGGGTGATCTTGGAAGGG + Intronic
944381716 2:199118154-199118176 GGGAAATGGTCTTCTTGTATAGG - Intergenic
1169427006 20:5504376-5504398 GACAAAGGGTGCTCCTGCACCGG - Intergenic
1169563738 20:6829836-6829858 TGCAAAGGATGTTCTTCTAAGGG - Intergenic
1170131322 20:13023072-13023094 GGTAAAGGGTGTTCCAGGACGGG - Intronic
1171030013 20:21668905-21668927 GGCCAAGGGTGTCCTTGGATGGG - Intergenic
1172379965 20:34481678-34481700 GGCAAAGAGAGAGCTTGTACAGG + Intronic
1173051283 20:39564304-39564326 GACAAAGGTAGTTCTTGTTCAGG + Intergenic
1174542760 20:51303027-51303049 GGCAAAGTGTGTGCTTTTAAAGG - Intergenic
1174548718 20:51345614-51345636 GACAAAGGGTGTTTCTGCACAGG + Intergenic
1175112733 20:56660113-56660135 GGTGAAGGGTGTCCTTATACAGG + Intergenic
1176358377 21:5971762-5971784 GGCAAAGAGAGATCTTGTGCAGG - Intergenic
1177067562 21:16459993-16460015 GGCAAAGAGAGAGCTTGTACAGG + Intergenic
1179765141 21:43566788-43566810 GGCAAAGAGAGATCTTGTGCAGG + Intronic
1183794254 22:40102272-40102294 GCCAAAGTGTGTGTTTGTACAGG + Intronic
950245139 3:11408667-11408689 GGCAAAGAGAGAGCTTGTACAGG + Intronic
952133945 3:30396205-30396227 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
955365143 3:58304437-58304459 GGCAAAGGGTTGCCTTGCACAGG - Intergenic
965898943 3:173615084-173615106 AGCAAAGGGTGTTCTTATAGGGG + Intronic
966191988 3:177279910-177279932 GGCTAACGATGTTCTTTTACAGG - Intergenic
968137010 3:196227053-196227075 GGCAAAGGGTGTTCTTGTACAGG - Exonic
968175747 3:196548111-196548133 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
973004497 4:44991011-44991033 GGAAAAGGGTGTGCTGGTCCTGG - Intergenic
973111620 4:46404394-46404416 GTCAAAGGGCTTTCTTATACTGG + Intronic
977080403 4:92520055-92520077 GACAAAGGGTGGACTTGTAAAGG - Intronic
978323496 4:107524418-107524440 GGCAAAGGGAGGTCTAGAACTGG - Intergenic
985844224 5:2332248-2332270 GGCAAAGGGGGAGCTTGTGCAGG + Intergenic
986852585 5:11830481-11830503 GGCAAAGGGAGAGGTTGTACAGG - Intronic
986892660 5:12328072-12328094 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
988996856 5:36723248-36723270 GGCAGAGGCTGTTCTTGCGCTGG - Intergenic
989436959 5:41425394-41425416 GGGAAAGAGTGTGCATGTACTGG - Intronic
996177748 5:120379803-120379825 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
996222530 5:120950774-120950796 GGCAAAGGGAGAGCTTGTGCAGG - Intergenic
996669347 5:126099123-126099145 GACATAGGATGTTCTTGTGCTGG - Intergenic
997593049 5:135087211-135087233 GGCAAAGGGTGGTCCTGCCCAGG + Intronic
999482193 5:151958855-151958877 GGCAAAGAGAGATCTTGTGCAGG - Intergenic
1003415557 6:5904871-5904893 GGGAAAGGGTGTACTGGGACTGG - Intergenic
1010530842 6:76965769-76965791 GGCAAAGAGTGAGCTTGTGCAGG - Intergenic
1013989177 6:116233649-116233671 GGCAAAGTGCATTCTTGTCCTGG + Intronic
1014626756 6:123735606-123735628 TGAAAAGGGTGTTCTTTTGCAGG - Intergenic
1015028158 6:128562262-128562284 GGCAAAGTTTGTTCTTGTCTTGG + Intergenic
1015081780 6:129235068-129235090 GGCAAACTAAGTTCTTGTACAGG - Intronic
1018620027 6:165721198-165721220 GGCACAGGGTTTTCTTGACCTGG + Intronic
1023181079 7:37484528-37484550 TGCAAAGGTGGTTTTTGTACTGG + Intergenic
1027557305 7:79681750-79681772 GGCAAAGAGTGAGCTTGTGCGGG - Intergenic
1027681008 7:81222042-81222064 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
1030412941 7:109204496-109204518 GGCAAAGAGAGATCTTGTGCAGG + Intergenic
1032586197 7:133149219-133149241 TGCAAAGGCTGTTCTTGAAATGG - Intergenic
1033871591 7:145761311-145761333 GGCAAAGGGAGATCTTATGCAGG - Intergenic
1033938961 7:146627119-146627141 GGCAAAGGGAGAGCTTGTACAGG + Intronic
1034762979 7:153690845-153690867 GGCAAAGAGTGAGCTTGTGCAGG + Intergenic
1038358770 8:26856698-26856720 GGCTAAGGGTGGTCCTGGACTGG - Intronic
1038489228 8:27957878-27957900 GGCAAATGGTTTTCTTGTGAAGG + Intronic
1039125292 8:34194644-34194666 AACAAAGGGTGTTCTTGCAATGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1040536727 8:48317062-48317084 GGCAAAGGGTGTGCTGGACCAGG + Intergenic
1042979746 8:74512847-74512869 AGCAGAGGGTGTGCTTGGACAGG - Intergenic
1044318339 8:90774952-90774974 GGCAAAGAGAGAGCTTGTACAGG + Intronic
1047565482 8:126039578-126039600 GGCAAAGGGAGAGCTTGTGCAGG - Intergenic
1050186519 9:2980928-2980950 GGCAAAAGGAGTTCTTATAAAGG + Intergenic
1050213831 9:3298312-3298334 GGTAAAGGGTGGTCTTCTTCTGG - Intronic
1051263791 9:15291357-15291379 GGCAAAGAGAGAGCTTGTACAGG - Intronic
1058108125 9:100998913-100998935 GACAGAGGGTGTTCCTGTAAAGG - Intergenic
1059100023 9:111461874-111461896 GGCAAAGGGACAGCTTGTACAGG + Intronic
1060622850 9:125083183-125083205 GGCAAAGAGTGAGCTTGTGCAGG - Intronic
1185717951 X:2358338-2358360 GGCAAAGGGTGTGCTTTCAATGG - Intronic
1187072217 X:15900132-15900154 GGCAAAGGGAGAGCTTGTGCAGG + Intergenic
1187792897 X:22970115-22970137 GGCAAAGAGAGAGCTTGTACAGG - Intergenic
1187854015 X:23619309-23619331 GGCAAAGAGAGAGCTTGTACAGG + Intergenic
1188607270 X:32046773-32046795 GGAAAAGGTTGTTCTTCCACAGG - Intronic
1190266544 X:48830642-48830664 GCCAAAGAGTGTGCCTGTACTGG + Intergenic
1193011596 X:76681690-76681712 AGCAAAGGGAGTTCTTGTTTAGG - Intergenic
1193407829 X:81123949-81123971 GGAAAAGGTTGTACTTGTTCAGG + Intronic
1196782164 X:119393306-119393328 GGCAAAGAGAGAGCTTGTACAGG + Intergenic
1197637445 X:128930927-128930949 GGCAAAGGGAGAGCTTGTGCAGG - Intergenic
1197936946 X:131749413-131749435 GTCAAAGAGTCTTCTTGTATTGG + Intergenic
1198593364 X:138209402-138209424 GGCAAGGGGTGGACTTGTAATGG - Intergenic