ID: 968141864

View in Genome Browser
Species Human (GRCh38)
Location 3:196264684-196264706
Sequence CAGGTATTAGATGCCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968141864 Original CRISPR CAGGTATTAGATGCCTGGGT TGG (reversed) Intronic
900748402 1:4377179-4377201 CAGGAAGTGGGTGCCTGGGTTGG + Intergenic
905730964 1:40299460-40299482 CAGGTATTACATACCTGGTGGGG - Intergenic
908569847 1:65397827-65397849 AAGGTACTAGATGACTTGGTTGG + Intronic
910310408 1:85817476-85817498 CAAGGATTAGATGCCTGCTTTGG - Intronic
911084846 1:93967802-93967824 TACGTATTTGATGCCTGTGTGGG + Intergenic
912362926 1:109109919-109109941 CAGGTATTTGATGCCAGCATAGG + Intronic
916464630 1:165061932-165061954 CAAGAATTAGATGCATGGGCTGG + Intergenic
917352302 1:174090858-174090880 CATTTAATAAATGCCTGGGTTGG - Intergenic
918322906 1:183381932-183381954 CTGGAATCAGATGCCTGGTTTGG - Intronic
918379155 1:183937262-183937284 CTGGTATGGGATGCCTGGGAGGG + Exonic
920716340 1:208343825-208343847 AAGGTATTACATGCCTGGGAAGG - Intergenic
1065297948 10:24294360-24294382 AAAGAATTAGATGTCTGGGTAGG - Intronic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1074827524 10:117225152-117225174 CAGGGATCAGAGGCCTAGGTTGG + Intergenic
1075820125 10:125300536-125300558 CAGCTATTAGATGTCAGGGGGGG + Intergenic
1078327226 11:10390482-10390504 CATTTATTAGATGACTGGATGGG - Intronic
1081663986 11:44905830-44905852 CAGGTTTTAGATCCCCAGGTAGG + Intronic
1084244553 11:67847846-67847868 CAGGTTTTATATGGCTGTGTTGG + Intergenic
1084407058 11:68980153-68980175 CAGGAAGTAGATGACGGGGTTGG + Exonic
1088544139 11:110942888-110942910 CAGTTATTAGGTGCCTGGGGTGG - Intergenic
1091282043 11:134387344-134387366 CAGTTTTAAGATGCCTGGGATGG - Intronic
1092127163 12:6082974-6082996 CAGGTTTTAGAAGCATGGTTGGG + Intronic
1095117445 12:38371751-38371773 CAGGAATTAAATGCCTGTGGTGG - Intergenic
1100628248 12:96359113-96359135 CAGGTATTAGATACGTTGGTGGG - Intronic
1101756850 12:107627751-107627773 CAGGATTCAGATGACTGGGTTGG - Intronic
1107975449 13:45683934-45683956 CAGGCAGGAGTTGCCTGGGTGGG - Intergenic
1112195952 13:97226461-97226483 CAGGTATTAGGTTACTGAGTTGG - Intronic
1116001214 14:39244450-39244472 GAGGTAGTAGATGGCAGGGTTGG + Intronic
1117675184 14:58148391-58148413 CAGGGTTTGGATACCTGGGTAGG - Intronic
1121507905 14:94490480-94490502 CAGGAATGAGATCCTTGGGTAGG - Intronic
1122043373 14:99006625-99006647 CATTTATTAGATGGCTGGTTTGG - Intergenic
1127004490 15:54550919-54550941 CAGATATTAGATGCATGGCCAGG - Intronic
1136488828 16:30591478-30591500 CAGGCAGTGGATGCCTGGGAAGG - Intergenic
1144863077 17:18317948-18317970 CAGGGAGTAGATGGCTGGGTGGG - Exonic
1148069530 17:44899868-44899890 TATGTATTAAATGCCTGGGGAGG + Intronic
1148617431 17:49011815-49011837 TAGGTATGAAATGCCTGGGGAGG - Intronic
1149634444 17:58155583-58155605 CTGGTAGTAGCCGCCTGGGTGGG + Exonic
1151455412 17:74222811-74222833 CAGGAATCAGATGCCTGGGGTGG + Intronic
1152047975 17:77950906-77950928 CAGGTATTAGATGTGAGGGTGGG - Intergenic
1152501697 17:80715431-80715453 CAGGGATTAAATGCCTGGCATGG - Intronic
1157947467 18:51997013-51997035 CAGGTATTGGATGGCTCAGTGGG - Intergenic
1158407361 18:57171941-57171963 CAGGAGTTAGAAGCCTGGCTTGG + Intergenic
1158421630 18:57299906-57299928 CTGGGATCAGAAGCCTGGGTAGG - Intergenic
1164548151 19:29186098-29186120 CAGGTAGCATCTGCCTGGGTAGG - Intergenic
1164846555 19:31437767-31437789 CAGGTTTGAGATGCCTGGCCAGG + Intergenic
1165007343 19:32817911-32817933 CAGATCTAGGATGCCTGGGTGGG - Intronic
1165054303 19:33164334-33164356 CAAGTATAAAATTCCTGGGTGGG + Intronic
1165289273 19:34870114-34870136 GTGCAATTAGATGCCTGGGTAGG + Intergenic
1166705865 19:44907696-44907718 TAGGTACTAGATGCCTGGACGGG + Intronic
1167802871 19:51756638-51756660 CACATGTCAGATGCCTGGGTTGG - Intronic
930875465 2:56210614-56210636 CACGTATCATATGCCTGGGCTGG + Intronic
931119217 2:59197905-59197927 CAGTTGTAAGATGCCTGGCTGGG - Intergenic
931645213 2:64416061-64416083 CAGTTATTAGGTGTCTGTGTGGG + Intergenic
932343292 2:70979812-70979834 CAGGTAGTAGATGCAGGGGAGGG - Exonic
933145924 2:78852359-78852381 AAGATATTATATGCCTGGCTTGG + Intergenic
937722185 2:125113643-125113665 CAGGCATTAGAGGCCTTGGTAGG + Intergenic
943519542 2:188931119-188931141 AAGGTGTAAGATGCCTAGGTAGG - Intergenic
945265023 2:207882309-207882331 CAGTTATAAAAGGCCTGGGTTGG + Intronic
946239136 2:218343345-218343367 GAGGGAATAGATGCCTGGGGTGG + Intronic
946437669 2:219668687-219668709 AAGGTATCTGATGCCTGGGAAGG - Intergenic
946459930 2:219859864-219859886 CATGTATTAAATGCCAAGGTGGG - Intergenic
1169951353 20:11047610-11047632 CAGGTTCTAGCTACCTGGGTTGG - Intergenic
1172646093 20:36470615-36470637 CAGTGATTAGGTGTCTGGGTAGG - Intronic
1175639143 20:60612481-60612503 TAGGGATTGGATGGCTGGGTTGG - Intergenic
1175695409 20:61099530-61099552 CAGGTATAAGAGCCCTTGGTGGG + Intergenic
1178943593 21:36927872-36927894 TAGGGATTGGATGCCTGGGCTGG - Intronic
1182753249 22:32658262-32658284 CAGGTGGGAGATCCCTGGGTAGG + Intronic
1182925792 22:34123541-34123563 GAGGTAGTAGATGGCAGGGTTGG - Intergenic
949815357 3:8052525-8052547 CAGGAATTACATGCCAGGCTCGG - Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952993562 3:38855128-38855150 CAGGTCTGAGATCCCTGAGTAGG + Intronic
962533176 3:136302366-136302388 CAGGCAATTGTTGCCTGGGTGGG + Intronic
964113176 3:153108064-153108086 CAGGTATGAGCTGCCTCGCTTGG - Intergenic
966890560 3:184404725-184404747 CAGGCCTTAGAGGCCTGGGCAGG + Intronic
968141864 3:196264684-196264706 CAGGTATTAGATGCCTGGGTTGG - Intronic
968141944 3:196265555-196265577 CAAGTAGTAGATACCTGGGTTGG - Intronic
969311607 4:6356228-6356250 CAGGTACTAGGTGCTTGGCTGGG - Intronic
977240429 4:94561716-94561738 AAAGTATTAGATTCCTTGGTGGG - Intronic
980945342 4:139314566-139314588 CAGGTATTAGATGCAAGACTAGG - Intronic
985973434 5:3394910-3394932 CAGGTATTAGAAGCCCAGGCAGG - Intergenic
986853416 5:11839574-11839596 CACATGTTTGATGCCTGGGTGGG + Intronic
987215097 5:15727469-15727491 CAGATATTGGATTCTTGGGTTGG + Intronic
992791302 5:80216549-80216571 CAGGTATTTGTTGCCTCAGTGGG - Intronic
993061250 5:83041802-83041824 CAGGTATTTGAAACCTGGCTTGG - Intergenic
994539133 5:101072360-101072382 CAGGGATAAGATGACTCGGTAGG - Intergenic
997795816 5:136809900-136809922 CAGGTGTTAAATGCTTGGATGGG - Intergenic
1004136863 6:12975860-12975882 CAGGCATGAGCTGCCTTGGTAGG + Intronic
1009597696 6:65756743-65756765 CAGTAATTAGATTGCTGGGTCGG - Intergenic
1013779542 6:113714688-113714710 CAGGTGGCTGATGCCTGGGTTGG + Intergenic
1017589539 6:155963702-155963724 CAGCTATTGGATGCCTGACTGGG - Intergenic
1020122164 7:5510827-5510849 CAGGAATGAGGTGCCTGGTTGGG - Intronic
1020322884 7:6953106-6953128 CAGGTTTTATATGGCTGTGTTGG + Intergenic
1021759823 7:23892736-23892758 CAGCTATTGGATGACTGTGTGGG - Intergenic
1021767760 7:23966663-23966685 CAGGTCTCTGATGGCTGGGTTGG - Intergenic
1024257252 7:47548309-47548331 CAGGTATGGGAAGGCTGGGTAGG - Intronic
1028019281 7:85750170-85750192 CAGTTAGGAGCTGCCTGGGTGGG - Intergenic
1029548456 7:101223614-101223636 CAGGTGTTCGCTGCGTGGGTGGG + Intronic
1030094958 7:105890678-105890700 TATGTATTAGAATCCTGGGTTGG - Intronic
1033430900 7:141288729-141288751 CTGGTATTCGCTGCCTGTGTGGG - Intronic
1039279300 8:35965830-35965852 CTGCTATTATATGCTTGGGTGGG - Intergenic
1041642781 8:60220481-60220503 TAGTTATTTGATGCTTGGGTTGG + Intronic
1047450687 8:124962772-124962794 CAGAGTTTAAATGCCTGGGTAGG + Intergenic
1048653145 8:136503364-136503386 GAGGTATTAAATGACAGGGTTGG + Intergenic
1048675686 8:136776782-136776804 CAGGTTTCAGATGCATGGGTGGG - Intergenic
1054880196 9:70136530-70136552 CAGTTATTAGATGTGTGGGAGGG - Intronic
1060714418 9:125909790-125909812 CAGGTACTAGACTCCTGGGCAGG - Intronic
1188985351 X:36763922-36763944 TAGGCATGACATGCCTGGGTGGG - Intergenic
1192437525 X:71152140-71152162 GATGTCATAGATGCCTGGGTTGG + Intronic
1197072424 X:122314881-122314903 CTGGTATTAGATACCTGTGAAGG + Intergenic
1198800796 X:140445896-140445918 CATGAATAATATGCCTGGGTAGG - Intergenic