ID: 968147660

View in Genome Browser
Species Human (GRCh38)
Location 3:196312797-196312819
Sequence CTCAAACACAAAAGAATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 538}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968147652_968147660 27 Left 968147652 3:196312747-196312769 CCGCGCCTGGCCCATAGTATATT 0: 1
1: 5
2: 33
3: 323
4: 2168
Right 968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG 0: 1
1: 0
2: 8
3: 41
4: 538
968147654_968147660 17 Left 968147654 3:196312757-196312779 CCCATAGTATATTCTACTTTAAA 0: 1
1: 0
2: 2
3: 28
4: 419
Right 968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG 0: 1
1: 0
2: 8
3: 41
4: 538
968147655_968147660 16 Left 968147655 3:196312758-196312780 CCATAGTATATTCTACTTTAAAG 0: 1
1: 0
2: 1
3: 24
4: 299
Right 968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG 0: 1
1: 0
2: 8
3: 41
4: 538
968147653_968147660 22 Left 968147653 3:196312752-196312774 CCTGGCCCATAGTATATTCTACT 0: 1
1: 0
2: 1
3: 10
4: 220
Right 968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG 0: 1
1: 0
2: 8
3: 41
4: 538
968147651_968147660 30 Left 968147651 3:196312744-196312766 CCACCGCGCCTGGCCCATAGTAT 0: 2
1: 18
2: 203
3: 1716
4: 8916
Right 968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG 0: 1
1: 0
2: 8
3: 41
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968147660 Original CRISPR CTCAAACACAAAAGAATCCA GGG Intronic
901495671 1:9620173-9620195 CTCACACAAGAAAGAATTCAGGG - Intergenic
901709456 1:11102255-11102277 CTGAAAGACAAGATAATCCATGG - Intergenic
903150214 1:21402375-21402397 CTCACACAAGAAAGAATTCAGGG - Intergenic
903571225 1:24307051-24307073 CTCACATACAAAATAATCTAAGG - Intergenic
905796428 1:40818935-40818957 TTCAAACCCAGAAGCATCCAGGG - Intronic
905994765 1:42372177-42372199 ATCACACACAATAGAATTCAAGG - Intergenic
906245429 1:44270164-44270186 CACACACACAAAAGAAACCCTGG + Intronic
907009206 1:50947263-50947285 TTCAATCATTAAAGAATCCAGGG + Intronic
907134807 1:52130079-52130101 CTCAAAAAAAAAAGTATCGATGG + Intergenic
907656329 1:56345565-56345587 CTCAAACCCACAAAAATACATGG + Intergenic
908126091 1:61031692-61031714 CTCAAAAACAGAAGAAGGCATGG - Intronic
908722290 1:67138509-67138531 CACAAACAAGAAAGAATCCCAGG - Intronic
908752843 1:67441322-67441344 CTCAAACAAAAAGGAACTCAAGG - Intergenic
908941356 1:69438432-69438454 CTAAAATACAAAAGGATACAAGG - Intergenic
909099199 1:71330043-71330065 CTCAAATAAAAAATAATACAAGG - Intergenic
911450657 1:98056219-98056241 CTGAAACACAAAAAGATCCTTGG + Intergenic
911875349 1:103155504-103155526 CTAAAAAAAAAAAGAATGCACGG - Intergenic
911897057 1:103449537-103449559 CTCATACACAAGAGAATATATGG - Intergenic
913308923 1:117465627-117465649 CTCAAACAAATAAGAGTACAAGG + Intronic
914431791 1:147625314-147625336 CAAAAACAGAAAAGAATCCTGGG - Exonic
914442578 1:147720373-147720395 CTCACACAAGAAAGAATTCAGGG - Intergenic
914689716 1:150014915-150014937 CTCAATTAAAAAAAAATCCAGGG + Intergenic
914795523 1:150916981-150917003 CTCAAAAAAAAAAGAAGCTAAGG - Intergenic
914865100 1:151420315-151420337 CTCAAAAAACAAAGAATCAATGG - Intronic
914944955 1:152056354-152056376 ATAAAACACAAAAGAAAGCAAGG - Intergenic
915380751 1:155437847-155437869 AACAAACACAAAAGAAGCAAAGG - Intronic
915413440 1:155721034-155721056 CTCAAAAAAAAAAGAAGACAAGG + Intronic
916608076 1:166362909-166362931 CTCAAAACTAAAAGAAACCATGG - Intergenic
916637834 1:166692908-166692930 CTCATGCAAAAAAGAATTCAGGG + Intergenic
916787964 1:168099804-168099826 CTTAAAAACAAAATAATCCCTGG - Intronic
917177682 1:172255435-172255457 GTCAAACAAAATTGAATCCATGG + Intronic
917195301 1:172457828-172457850 TTCAAACACAAAAGTGCCCAGGG + Intronic
917432078 1:174980695-174980717 CACAAACAAAATAAAATCCAAGG - Intronic
917490913 1:175497722-175497744 ACCTAACACTAAAGAATCCAAGG - Intronic
917927046 1:179798219-179798241 CTCAAAAAAAAAAGAATATAAGG + Intronic
918347789 1:183621511-183621533 CTCACACAAGAAAGAATTCAAGG + Intergenic
918938651 1:190960002-190960024 TACATACACAAAAAAATCCATGG - Intergenic
920112973 1:203599960-203599982 CTCACACAAGAAAGAATCCGAGG + Intergenic
920289230 1:204905526-204905548 CTCAAAAACAAAAAAAGCGAAGG - Intronic
921158939 1:212459374-212459396 CCAAAACACAAAAGAACACAAGG - Intergenic
921368089 1:214393882-214393904 CTCAAGCACAAAATAATACATGG + Intronic
921779138 1:219140947-219140969 TTCAAACACAGAAAATTCCATGG - Intergenic
922082708 1:222312452-222312474 CTCAGTCACAGAAGAACCCATGG - Intergenic
922408330 1:225342297-225342319 TTCAAACATAAAAGAACCCAGGG + Intronic
922815965 1:228449676-228449698 CTCATACAAGAAAGAATTCAGGG - Intergenic
923481819 1:234392333-234392355 CTCAAAAACAAAAAAAAACAAGG + Intronic
923848319 1:237762997-237763019 CTACAACAAAAAAGAATGCACGG - Intronic
924151955 1:241138586-241138608 CTCAAACTCTTAAGTATCCATGG - Intronic
924208680 1:241742740-241742762 CTCACACAAGAAAGAATTCAAGG - Intronic
924335605 1:242984155-242984177 CTCTAACACAAAATTACCCATGG - Intergenic
924448620 1:244157683-244157705 CTCACACAAGAAAGAATCCTGGG + Intergenic
924535336 1:244931041-244931063 CTCAAAAACAAAAAAAAACAAGG - Intergenic
924647031 1:245887482-245887504 CTCACACAAGAAAGAATTCAGGG - Intronic
1063354211 10:5382711-5382733 CTCATGCAGAAAAGAACCCAGGG + Intergenic
1063751083 10:8948067-8948089 CTCACACAAAAAGGAATTCAGGG - Intergenic
1063819128 10:9813997-9814019 CTCAAATGCAAAAGATTCCCTGG - Intergenic
1064098589 10:12443499-12443521 CTCACACAAGAAAGAATTCAGGG + Intronic
1064536021 10:16358716-16358738 CTCAAGCAATAAAGAATTCAGGG - Intergenic
1064570272 10:16685340-16685362 CTCACACAAGAAAGAATTCAGGG + Intronic
1064803516 10:19103793-19103815 CTCAAAAACAAAGAAATGCAGGG - Intronic
1064867417 10:19896610-19896632 CTCAAATATAAAAAAATCAAAGG - Intronic
1064952811 10:20873007-20873029 CTCACACAAGAAAGAATTCAGGG - Intronic
1065057575 10:21862264-21862286 CTCACACAACAAAGAATTCAGGG - Intronic
1065173488 10:23054656-23054678 CTCAAGCAAGAAAGAATTCAGGG + Intergenic
1065384797 10:25124308-25124330 CTCACACAAGAAAGAATTCAGGG - Intergenic
1065486689 10:26242557-26242579 CACAAATAGAAAGGAATCCATGG - Intronic
1065505360 10:26425177-26425199 CTCACACAAAAAGGAATTCAAGG - Intergenic
1065732433 10:28721788-28721810 TTCAAAAACAAAAAAATCCAAGG + Intergenic
1065831566 10:29619052-29619074 ATCAAACACAGAACAAACCATGG + Intronic
1066380716 10:34899121-34899143 ATAACACACAAAGGAATCCAAGG - Intergenic
1067374785 10:45717821-45717843 CTCAAACACAAAAAAGTCCAAGG + Intergenic
1067378943 10:45754729-45754751 CTCAAACACAAAAAAGTCCAAGG - Intronic
1067811788 10:49433814-49433836 CTCAAAAAAAAATGAATACATGG + Intergenic
1067882598 10:50059459-50059481 CTCAAACACAAAAAAGTCCAAGG + Intergenic
1067886645 10:50095391-50095413 CTCAAACACAAAAAAGTCCAAGG - Intronic
1068047312 10:51903516-51903538 CACACACACAGAAGAATACATGG + Intronic
1068129678 10:52881966-52881988 GTCAAAGACAAAACAACCCAAGG - Intergenic
1069018913 10:63464964-63464986 CTAAAACACATAGGAATCCCCGG + Intronic
1069047356 10:63757173-63757195 CTCAAAAAAAAAAAAATCCTTGG + Intergenic
1070251332 10:74776186-74776208 CTCATACAAGAAAGAATTCAGGG - Intergenic
1071951381 10:90706436-90706458 CACACACATAAAAGAATGCATGG + Intergenic
1073802125 10:107053377-107053399 TTCAAGAACAAAACAATCCACGG + Intronic
1073990450 10:109256805-109256827 CTCACACAAGAAAGAATTCAGGG + Intergenic
1074876639 10:117618782-117618804 CTCACACAAGAAAGAATTCAGGG - Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075540521 10:123309739-123309761 CTCAAGCACATAAAAATACAAGG - Intergenic
1075977475 10:126708127-126708149 CTCACACAATAAAGAATTCAGGG + Intergenic
1077731689 11:4737667-4737689 CACAAAAACAAAAAAACCCAGGG + Intronic
1077859322 11:6160792-6160814 CTCACACAAGAAAGAATTCAGGG + Intergenic
1078986589 11:16604668-16604690 CTCACACACAAAAGCAGCCCAGG + Intronic
1079237416 11:18700274-18700296 TTCAAACACCAAAGATTTCAAGG - Intronic
1079351153 11:19693165-19693187 CTCAAACACAGAGGAAACCAAGG - Intronic
1079965573 11:26976109-26976131 CTCACACAAGAAAGAATTCAAGG + Intergenic
1080236052 11:30069534-30069556 CTCACACACAAAAGAACACAAGG - Intergenic
1081478079 11:43456388-43456410 GGAAAACCCAAAAGAATCCATGG + Intronic
1081496266 11:43613665-43613687 CTCAAAAAAAAAAAAATTCATGG - Intronic
1081733261 11:45385908-45385930 CTCAAAGCCAAAGGAAGCCAAGG + Intergenic
1082692942 11:56327461-56327483 CTCAAAAACAGAAGAAGCCCAGG - Intergenic
1084600098 11:70140175-70140197 CTCACACAAGAAAGAATTCAGGG + Intronic
1085301289 11:75460294-75460316 CTCAAAAAAAAAAGAATCTCTGG - Intronic
1085361629 11:75893212-75893234 CTAAAACAAACAAGAAACCAAGG + Intronic
1085930256 11:81073169-81073191 CTCAGAAACAATAGAAGCCAAGG - Intergenic
1086541302 11:87915753-87915775 CTCACACAAGAAAGAATTCAAGG - Intergenic
1087074468 11:94116590-94116612 AACAAACAAAAAAGAAGCCAAGG - Intergenic
1087797324 11:102468266-102468288 CTCACACAAGAAAGAATTCAAGG + Intronic
1088239039 11:107755108-107755130 CTCAAAAACAAAAAAAACCAGGG + Intergenic
1088253427 11:107881123-107881145 CTCACACAATAAAGAATTCAGGG + Intronic
1088578491 11:111295701-111295723 CTCAAAAAAAAAAAAAGCCAGGG + Intergenic
1088681049 11:112242023-112242045 CTCACACAGGAAAGAATTCAGGG + Intronic
1089820992 11:121226062-121226084 CTCAAACAAGAAAGAATTCAAGG + Intergenic
1091248069 11:134117059-134117081 CTTAAAAAAAAAACAATCCACGG + Intronic
1092103120 12:5902580-5902602 CTCAATCACAAAAGAAGGGAAGG + Intronic
1092655920 12:10685529-10685551 CACAAACACAAATGTATTCATGG + Intergenic
1092815685 12:12310611-12310633 CTCAAAAAAAAAACAAACCACGG - Intergenic
1093921253 12:24862231-24862253 CTCACACAAGAAAGAATTCAGGG - Intronic
1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG + Intronic
1094638823 12:32253481-32253503 ATAAAAAAAAAAAGAATCCACGG - Intronic
1094699100 12:32851467-32851489 CTCAAACAAAAAAGAATTTAGGG - Intronic
1095043581 12:37472661-37472683 CTCACACAGGAAAGAATTCAAGG + Intergenic
1096597293 12:52704138-52704160 CTCAAACACAAAACCACACAAGG + Intergenic
1097840704 12:64318784-64318806 AACAAACACAAAAGAACCCCAGG - Exonic
1098419418 12:70277515-70277537 CTGAAAGACAAAAGCATCAAAGG + Intronic
1098439116 12:70499529-70499551 CTCATACAAGAAAGAATTCAGGG + Intergenic
1098580212 12:72090853-72090875 CTTAAAAAAAAAAAAATCCAAGG - Intronic
1098608522 12:72424444-72424466 CTTCAACATAAAAGAATACAAGG + Intronic
1099575537 12:84375445-84375467 CTCAATCAGAAAAGAAGCCAAGG + Intergenic
1099799828 12:87442945-87442967 CTCACACAAGAAAGAATTCAGGG + Intergenic
1100469975 12:94882111-94882133 CTCAAGCATAAAAGAACTCACGG + Intergenic
1100771925 12:97932922-97932944 CTCAACCACAACAGAAACCTAGG - Intergenic
1100829844 12:98507890-98507912 CTCACACAAGAAAGAATTCAAGG + Intergenic
1101169371 12:102073685-102073707 CTCAAAAGAAAAAAAATCCAAGG - Exonic
1102008851 12:109606012-109606034 CTCAAACTCACAAGCCTCCAGGG + Intergenic
1102340520 12:112117825-112117847 CTCAAAAAAAAAAGAAGCCAGGG + Intergenic
1102386844 12:112517159-112517181 CACACACACAAAAGGATACAGGG + Intergenic
1103335842 12:120189068-120189090 CTCAAATAAAAAAGGAACCATGG - Intronic
1103962111 12:124615469-124615491 CTCACACAAGAAAGAATTCAGGG + Intergenic
1104359680 12:128121056-128121078 CTCAACCACAAAAGCATGTATGG + Intergenic
1104431565 12:128720589-128720611 ATAAAAAACAAAAGAATCCTGGG + Intergenic
1104448207 12:128849770-128849792 CTCACACAAGAAAGAATTCAGGG + Intergenic
1104641870 12:130472131-130472153 CTCAGACCCAGTAGAATCCAAGG - Intronic
1105607142 13:21935359-21935381 CTCATCCACTAAAGAATCCTGGG - Intergenic
1106591049 13:31098866-31098888 CTCACACAAGAAAGAATTCAAGG - Intergenic
1106732989 13:32561223-32561245 CTCACACAAGAAAGAATTCAGGG - Intergenic
1107384784 13:39896258-39896280 CCCAAAAAGAAAAGATTCCAGGG - Intergenic
1107970968 13:45641843-45641865 CTCACACAAGAAAGAATTCAGGG - Intergenic
1108497812 13:51042560-51042582 CTGTAACACAAAAGCAGCCATGG + Intergenic
1108655227 13:52525195-52525217 CTCAAACCAAAAAAAATACAAGG + Intergenic
1109936324 13:69289645-69289667 CTCATGCAAAAAAGAATTCAGGG - Intergenic
1110859944 13:80337455-80337477 CACAAACACGAGAGACTCCACGG - Exonic
1110982806 13:81922933-81922955 CTCAAAGACATAAGAATCATTGG + Intergenic
1111724165 13:91983343-91983365 CTCAAAAAAAAAAGGACCCAAGG + Intronic
1111920643 13:94407454-94407476 CTCAAACACAAAAAATTCCATGG - Intergenic
1114764583 14:25356448-25356470 CTCACACAAGAAAGAATTCAAGG - Intergenic
1115617373 14:35108997-35109019 AGCAAACAAAAAAGAATGCAAGG - Intronic
1115733991 14:36303697-36303719 CACACACACATATGAATCCAGGG + Intronic
1116101518 14:40443676-40443698 CTCAAAAACAAAAGCAAACAAGG - Intergenic
1116187700 14:41618844-41618866 CTCAAAAATATATGAATCCATGG - Intronic
1116345692 14:43790527-43790549 CTCACACAAAAAAGAATTCAGGG + Intergenic
1118304583 14:64645181-64645203 CTCACACAAGAAAGAATTCAGGG - Intergenic
1118464528 14:66018914-66018936 CATAATCAAAAAAGAATCCAAGG + Intergenic
1119034667 14:71219426-71219448 CTCATACAAGAAAGAATTCAAGG + Intergenic
1119050398 14:71362227-71362249 CTAAATCACAAAATAATTCAAGG - Intronic
1119104264 14:71909283-71909305 CTCATGCAGAAAAGAATTCAAGG - Intergenic
1119962520 14:78875919-78875941 CTCATCCTCAAAAGAATACAAGG - Intronic
1120104964 14:80483319-80483341 CACAAACACAAAAGAAATAATGG + Intronic
1120436892 14:84493700-84493722 CTCACACAAGAAAGAATTCAGGG + Intergenic
1120662630 14:87268737-87268759 CTGAAATAAAAAAGAATGCAAGG - Intergenic
1120865885 14:89294922-89294944 CTCAAACAAGAAAGAATTCAGGG - Intronic
1121112402 14:91321279-91321301 CTCAAACACAAACGACTTCCTGG + Exonic
1121149425 14:91617953-91617975 CTCACACAAGAAAGAATTCAGGG + Intronic
1122193904 14:100070264-100070286 CTCAAAAAGAAAAGAAAACAAGG + Intronic
1122868618 14:104622871-104622893 CTCACACAAGAAAGAATTCAGGG - Intergenic
1202942112 14_KI270725v1_random:160254-160276 CTCACACAGGAAAGAATTCAAGG + Intergenic
1123811975 15:23936220-23936242 CAAAAACACAACAGAATTCAAGG + Intergenic
1126260379 15:46682502-46682524 CTCACACAAGAAAGAATTCAGGG - Intergenic
1126291308 15:47083186-47083208 CTCACACAGGAAAGAATTCAAGG - Intergenic
1126360618 15:47842189-47842211 CTAAATCAGAAAATAATCCACGG - Intergenic
1127026070 15:54808095-54808117 CTCACTCAAAAAAGAATTCAGGG + Intergenic
1127212091 15:56783898-56783920 CTCACACAATAAAGAATTCAGGG - Intronic
1127328473 15:57917107-57917129 CTGAAACCCAAAAGATGCCAAGG + Intergenic
1129935360 15:79443623-79443645 CTCAAAAACTTAAGAATGCATGG - Intronic
1130422444 15:83762007-83762029 CACTAACACAAAAGAAACCACGG - Intronic
1130757464 15:86780298-86780320 GTAGAACAGAAAAGAATCCAGGG - Intronic
1131181410 15:90242411-90242433 AAGAAACAGAAAAGAATCCAGGG - Exonic
1131889333 15:96955630-96955652 CTCATTCACCAAATAATCCAAGG + Intergenic
1132956664 16:2597958-2597980 AACAAACACAAAGGAATTCAGGG + Exonic
1134245675 16:12538114-12538136 CTCAAAAATAAAAAAATGCAAGG - Intronic
1134255998 16:12611934-12611956 CTCGTGCACAAAAGAATTCAGGG + Intergenic
1134350852 16:13436636-13436658 CTCATGCAAGAAAGAATCCAGGG - Intergenic
1134596943 16:15503280-15503302 CTCAAAAAAAAAAAAATCCTTGG - Intronic
1135169807 16:20173831-20173853 CTCATGCAAAAAAGAATCCAGGG - Intergenic
1137905582 16:52318763-52318785 CTCAAACACAGCAGCATCCCTGG - Intergenic
1137960484 16:52877279-52877301 CTCAAAAACAAAAGAATAGGTGG + Intergenic
1139619710 16:68128042-68128064 TTCAAACATGAAAGAACCCATGG - Intronic
1140281304 16:73557378-73557400 CTCACACAAGAAAGAATTCAGGG + Intergenic
1140741182 16:77943047-77943069 AACAAACAAAAAAGAATACAGGG - Intronic
1141222939 16:82088823-82088845 CTTAAACACAAAAGGTCCCAAGG - Intronic
1143535522 17:7536781-7536803 CTCAAAAACAAAAAAAGACAGGG - Intergenic
1144250239 17:13409061-13409083 CTCTAACACAAAAGCATCTGTGG - Intergenic
1146107703 17:30056270-30056292 CTCAAGGACAAAATAATGCAAGG - Intronic
1146291543 17:31611068-31611090 CTCACACAAGAAAGAATTCAGGG + Intergenic
1147023082 17:37555124-37555146 CTCAAAAAAAAAAGAATCATAGG - Intronic
1147402214 17:40187609-40187631 CTCAAAAAAAAAAGAAAACATGG - Intronic
1148063511 17:44852472-44852494 CTCAAAGCCAAAAGAGTCGATGG + Exonic
1149589142 17:57815567-57815589 CTGAAAGACAAAACTATCCATGG + Intergenic
1150547551 17:66176250-66176272 CTCAAATACCAAACAAACCAAGG + Intronic
1152821024 17:82437748-82437770 CTCACACAGGAAAGAATTCAAGG + Intronic
1152914305 17:83025093-83025115 CTCAAATAAAACAGAAACCATGG + Intronic
1154319727 18:13337893-13337915 CTCCAACACTGAAGAAACCATGG - Intronic
1154972431 18:21423855-21423877 CTCAAAGAAAAAAGAATGCGAGG + Intronic
1155383519 18:25250747-25250769 CTCAAACACAATAATTTCCATGG + Intronic
1155600124 18:27536010-27536032 CTCAAACATTAAATAATTCAAGG + Intergenic
1156336909 18:36180723-36180745 CTCAAACACAAAGGAATTACTGG + Intergenic
1156411514 18:36832711-36832733 CTCAAACATAAAAGAATGTCTGG - Intronic
1156551481 18:38023663-38023685 CACAGACACAAAAGACTGCATGG - Intergenic
1156713618 18:39978586-39978608 CTCAAAAACAGAATAATTCAGGG + Intergenic
1158212161 18:55064037-55064059 GTCAAACTCAAAAGACTACATGG - Intergenic
1158625603 18:59068960-59068982 TTAAAACACAAAAGAATGGATGG + Intergenic
1159676000 18:71285001-71285023 CTCACACAAGAAAGAATTCAGGG - Intergenic
1159692922 18:71513346-71513368 ATCAAAGACAAAAGGCTCCATGG - Intergenic
1160352153 18:78192874-78192896 TTCAAGCAAAAAAGAATGCATGG - Intergenic
1161520635 19:4721775-4721797 CTCAAAAACAAAAGAAGAGAGGG + Intronic
1161791652 19:6363567-6363589 CACAAACACAAATGCTTCCAGGG - Intronic
1162055411 19:8060679-8060701 CTCAAAAAAAAAAAAATCCCTGG - Intronic
1162935932 19:13981593-13981615 CTCAAAAACAAAACAAAACAAGG + Intronic
1163411087 19:17154969-17154991 CTCAAAAAAAAAAGAATGCTGGG + Intronic
1164518667 19:28959482-28959504 CTCAAGCAATAAAGAATTCAAGG - Intergenic
1164843382 19:31411582-31411604 CTCACACAAGAAAGAATTCAGGG + Intergenic
1164973510 19:32552481-32552503 CTCAAAAACAAAACAAAACATGG - Intergenic
1165048530 19:33125937-33125959 CTGAAACCCAAAAGAAGACATGG - Intronic
1165115086 19:33523798-33523820 CCCAAACACAAAATAATGGAAGG + Intergenic
1165123766 19:33580050-33580072 TTAAAATACAAAAGAAACCAGGG + Intergenic
1165181732 19:33977522-33977544 CTCGCACAAAAAAGAATTCAGGG - Intergenic
1166139473 19:40798463-40798485 ATGAAACAAAAAAAAATCCACGG - Intronic
1166893421 19:46008406-46008428 CTCAAAAAAAAAAGAATACGTGG - Intronic
1167200829 19:48063902-48063924 CTCATACAAGAAAGAATTCAGGG + Intronic
1168567043 19:57434095-57434117 CTCAAAAACAAAAAAAGACAAGG - Intronic
1168623283 19:57895834-57895856 CTCACACAAGAAAGAATTCAGGG + Intronic
924960569 2:30757-30779 CTCAGACTCAAAAGGAGCCATGG + Intergenic
925612192 2:5711059-5711081 CTCCAAAAAAATAGAATCCATGG + Intergenic
926204145 2:10823155-10823177 CTCAGATGCTAAAGAATCCAAGG + Intronic
926340475 2:11900991-11901013 CTCACACAAGAAAGAATTCAGGG - Intergenic
926603206 2:14869293-14869315 ATCAACCACAAAAGGATCCCAGG + Intergenic
926885756 2:17597111-17597133 CCCAAACCCACAAGAATACACGG - Intronic
927574870 2:24192502-24192524 CTCAAGCAAGAAAGAATTCACGG + Intronic
927763466 2:25782121-25782143 GACAAACACAAAAGAATCAGTGG - Intronic
928130282 2:28644108-28644130 CTTCAATAAAAAAGAATCCAGGG + Intergenic
928695650 2:33847385-33847407 CTCAAACACCACATATTCCATGG + Intergenic
928924155 2:36559800-36559822 CTCAACCTCAAAAGAAGACAAGG - Intronic
929719271 2:44350959-44350981 CTCAAACAAAAAAAAAGCCAGGG - Intronic
930092995 2:47544908-47544930 CTCAAGGACAAAAAAATCCCTGG + Intronic
930434449 2:51322939-51322961 CTCACACAAGAAAGAATTCAGGG + Intergenic
932529655 2:72515405-72515427 CTCAAATTCACAAGAATGCAGGG + Intronic
932827482 2:74955169-74955191 CTCACACAAGAAAGAATTCAGGG - Intergenic
932860827 2:75289584-75289606 CTCACACAAGAAAGAATTCAGGG - Intergenic
934116412 2:88800467-88800489 CTCAGCAACATAAGAATCCAAGG - Intergenic
934483183 2:94672888-94672910 CTCAAAAAAAAAAAAACCCATGG + Intergenic
934626741 2:95864378-95864400 CTCAGTAACATAAGAATCCAAGG + Intronic
934806816 2:97236913-97236935 CTCAGTAACATAAGAATCCAAGG - Intronic
934830693 2:97520262-97520284 CTCAGTAACATAAGAATCCAAGG + Intronic
935031188 2:99324257-99324279 CTCACACACAAAATACTTCATGG + Intronic
936883962 2:117286676-117286698 CTCAAAAAAAAAAAAATACACGG + Intergenic
937519481 2:122694274-122694296 CTCAGACACAAAATAAAGCATGG - Intergenic
937994193 2:127680641-127680663 CTCAGACTGAAAAGAATCCCTGG - Intronic
939197388 2:138990130-138990152 CTCACACAAGAAAGAATTCAGGG - Intergenic
940134218 2:150417735-150417757 CTCACGCAAAAAAGAATTCAAGG + Intergenic
941143215 2:161811092-161811114 CAGAAACACAAAACCATCCAAGG - Intronic
941274436 2:163472914-163472936 CACACACACAAAAGAGTCAAAGG + Intergenic
942127225 2:172839241-172839263 CTCACACAAGAAAGAATTCAGGG + Intronic
942209633 2:173657764-173657786 CTCAAAAAAAAAATAATCAATGG + Intergenic
942440167 2:176025623-176025645 CTCAAACTCAAATTAAGCCAAGG + Intergenic
942588949 2:177519788-177519810 CTCACACAAGAAAGAATTCAGGG + Intronic
942595411 2:177587471-177587493 CTGAAACAAAAAAGACCCCATGG + Intergenic
942681975 2:178486303-178486325 CACACACACAAATGAATCAATGG - Intronic
942817473 2:180069320-180069342 ATCAAAATCACAAGAATCCAAGG - Intergenic
943133638 2:183887132-183887154 CTGAAAGACAAAACCATCCATGG - Intergenic
943411248 2:187551290-187551312 TTCAAAAACAAAAGAATATAAGG - Intronic
943467024 2:188240584-188240606 CTCACACAAGAAAGAATTCAGGG - Intergenic
943548206 2:189308022-189308044 CTCACACAAGAAAGAATTCAGGG - Intergenic
943737051 2:191367480-191367502 CTCAAACTCAAATGTTTCCAGGG - Intronic
943874491 2:193045781-193045803 CACGAACACACAAAAATCCATGG + Intergenic
944440394 2:199737392-199737414 TTCAAATTCAAAAGTATCCAAGG - Intergenic
944520199 2:200557525-200557547 CTCACACAAGAAAGAATTCAAGG + Intronic
945109068 2:206345345-206345367 CTCACACAAGAAAGAATTCAGGG + Intergenic
945118624 2:206435624-206435646 CTCAAATACAAAAGATCTCAAGG - Intergenic
945222037 2:207493660-207493682 CACAAACACAAAAGAATATTGGG + Intergenic
945507446 2:210658799-210658821 CTCAGACACAAACAGATCCAGGG - Intronic
945707916 2:213258702-213258724 CTCAGACACAAAACAATCTGGGG + Intergenic
946424714 2:219587599-219587621 CTCATGCAAAAAAGAATTCAGGG + Intergenic
946730501 2:222704941-222704963 CTCACACAAGAAAGAATTCAGGG + Intronic
947231760 2:227894413-227894435 CTTAAAAAAAAAAGAATACAAGG + Intronic
947339159 2:229119245-229119267 GTAAAACAGAAAAGAATACAGGG - Intronic
947522528 2:230858439-230858461 CTCAAATAAAAAAGAATACAAGG + Intergenic
948194999 2:236088713-236088735 ATCAAACAAAAGAGAATCTATGG - Intronic
1168823166 20:790836-790858 CTCACACAAGAAAGAATCCAGGG - Intergenic
1171538039 20:25915418-25915440 CTCACACAGGAAAGAATTCAAGG + Intergenic
1171840975 20:30210717-30210739 CTCACACAGGAAAGAATTCAAGG + Intergenic
1172177503 20:32981131-32981153 CACAAACACTACATAATCCACGG - Intergenic
1172607305 20:36222601-36222623 CTGAAACCCCAAAGAAACCAAGG - Intronic
1172812986 20:37663570-37663592 TTCACACAAGAAAGAATCCAGGG + Intergenic
1172851650 20:37970805-37970827 TTCATACACAAAAGAAAGCAAGG + Intergenic
1174143296 20:48432197-48432219 CTCACACAAGAAAGAATTCAGGG + Intergenic
1174882106 20:54291229-54291251 CTCAAGCAAGAAAGAATTCAGGG - Intergenic
1175125950 20:56751566-56751588 CCAAAACCCAACAGAATCCAGGG - Intergenic
1175181449 20:57150906-57150928 CTCACACAAGAAAGAATTCAGGG + Intergenic
1176127161 20:63480868-63480890 CTCAAAAAAAAAAGAAAACATGG + Intergenic
1176256821 20:64157283-64157305 CTCAAACCCTAATGCATCCACGG + Intronic
1176581058 21:8526676-8526698 CTCACACAGGAAAGAATTCAAGG - Intergenic
1177593014 21:23197441-23197463 ATTAAGCACAGAAGAATCCATGG - Intergenic
1177930543 21:27277647-27277669 CACACACACAAATGAATTCAAGG - Intergenic
1178022904 21:28430325-28430347 CCCAACAAGAAAAGAATCCAGGG + Intergenic
1178112950 21:29387334-29387356 CTCACACAAGAAAGAATTCAGGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179110824 21:38443576-38443598 CTGAAACACAGAAGAATGCAGGG - Intronic
1180131828 21:45831660-45831682 CTCACACAAGAAAGAATTCAGGG + Intronic
1180926966 22:19561915-19561937 CTCAAACACCAAGGACTCCTTGG + Intergenic
1182237677 22:28889112-28889134 CTCAAAAAAAAAAGAAACCCAGG + Intronic
1182521443 22:30886883-30886905 CTCACACAAGAAAGAATTCAAGG + Intronic
1182638309 22:31747108-31747130 CTCAAAAAAAAAAGACTCCTGGG - Intronic
1182785535 22:32904492-32904514 GTCTAACACAAAAGAAGCCTAGG - Intronic
1182962257 22:34486480-34486502 CTCTAACTCAGTAGAATCCAGGG + Intergenic
1184382365 22:44153164-44153186 CTCAAACAGAAAATAATCTGAGG - Intronic
949323881 3:2842318-2842340 CCCAAACACAAAATCTTCCAGGG + Intronic
950500846 3:13362674-13362696 CTCACACACAAACAATTCCAAGG + Intronic
950511399 3:13430311-13430333 CTCACACAAGAAAGAATTCAGGG + Intergenic
950593156 3:13953722-13953744 CTCAAGCAAGAAAGAATTCAAGG + Intronic
950778101 3:15367688-15367710 CTCAAACAGAACAGAAGGCAGGG - Intergenic
951726312 3:25764723-25764745 CAGCCACACAAAAGAATCCAGGG + Intronic
952451486 3:33438004-33438026 CACAACCAAAAAAGAATTCAAGG + Intronic
953274552 3:41482118-41482140 CTCATGCAAAAAAGAATTCAGGG - Intronic
953570171 3:44065219-44065241 CTCAAACCAAACAAAATCCAGGG + Intergenic
953609111 3:44432892-44432914 AGCAGACACAAAGGAATCCATGG - Intergenic
953806681 3:46076301-46076323 CTCAAAGCCAGAAGAATACAAGG - Intergenic
953807484 3:46083541-46083563 CTCAAAGAAAAAAAAATGCATGG - Intergenic
955006950 3:54977787-54977809 CTCATACAAGAAAGAATTCATGG + Intronic
955045919 3:55359547-55359569 CTCACACACGAAAGAATTCAGGG - Intergenic
955380803 3:58436243-58436265 CTCACACAAGAAAGAATTCAGGG + Intergenic
955515840 3:59725692-59725714 CTCACACAGTAAAGAATTCAGGG + Intergenic
955918228 3:63927550-63927572 CTCAATCAAAAAAGAATACCAGG - Intronic
956664506 3:71630025-71630047 ATCTACCACATAAGAATCCAGGG - Intergenic
957300338 3:78384049-78384071 CTCAAACACAAAATAATTAAAGG + Intergenic
958906362 3:99946221-99946243 ATCAATCACAATAGTATCCAGGG - Intronic
959613996 3:108326650-108326672 CTCAAACACCAAGCACTCCAGGG - Intronic
959712629 3:109400218-109400240 TTTAAACACAAAAGAACTCAGGG + Intergenic
960102855 3:113763089-113763111 CTCAAAAAAAAAAGAATAAATGG - Intronic
960137786 3:114123208-114123230 CTCAAAAAAAAAAGAAGACATGG - Intergenic
960291431 3:115890163-115890185 CTAAATCTCAAAAGCATCCACGG + Intronic
960664913 3:120099433-120099455 CTCACACAAGAAAGAATTCAGGG + Intergenic
960974077 3:123158587-123158609 CTCAAAGGCCAAAGAAGCCAGGG + Intronic
961605173 3:128088601-128088623 CTCAAAAACAAAACAAAACAAGG - Intronic
962086223 3:132194755-132194777 ATCAAACACAGAAGAATTCTAGG + Intronic
962770983 3:138609859-138609881 CTAAAACAAGATAGAATCCACGG + Intronic
963088325 3:141459128-141459150 CTCACAGGCAAAGGAATCCACGG + Intergenic
963171788 3:142258291-142258313 CTCAAGCAAGAAAGAATTCAGGG - Intergenic
963234849 3:142946646-142946668 CTCATACAAGAAAGAATTCAGGG + Intergenic
964790333 3:160449116-160449138 CTGCAAGACAAAAGCATCCATGG + Intronic
964922043 3:161908703-161908725 CTCACACACAAAGGAATCTGTGG - Intergenic
965478394 3:169185904-169185926 CCCAAAGACAAAAGAAAGCATGG - Intronic
966106952 3:176347424-176347446 CTCACACAAGAAAGAATTCAGGG + Intergenic
966494462 3:180563940-180563962 CTCAGAAACAAAATATTCCAAGG + Intergenic
966646639 3:182252884-182252906 CAAAAGCACAAGAGAATCCAAGG - Intergenic
966721090 3:183063656-183063678 CTCACACAAGAAAGAATTCAGGG - Intronic
968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG + Intronic
968455142 4:693914-693936 ATCAAACAGAAAGGAATCCCTGG - Intergenic
968471162 4:783057-783079 CTCAAAAAAAAAAGACTCCAAGG + Intergenic
969964624 4:10981389-10981411 CTCAAGCAAGAAAGAATTCAAGG + Intergenic
970524924 4:16921712-16921734 CTCAAAAACAAAAGTATCCATGG - Intergenic
971005867 4:22374019-22374041 CTCACACAAGAAAGAATTCAGGG - Intronic
971889765 4:32505092-32505114 CTCAGACAAAATAGAAACCAAGG + Intergenic
972053803 4:34774527-34774549 CTCACACAAGAAAGAATTCAGGG - Intergenic
972304560 4:37819723-37819745 CTCAAAGACATATGAAGCCATGG + Intergenic
972723122 4:41720802-41720824 CTCACACAAGAAAGAATTCAAGG - Intergenic
972921322 4:43945975-43945997 CTCACACAAGAAAGAATTCAGGG + Intergenic
973856252 4:55013167-55013189 GACAAAAAAAAAAGAATCCATGG + Intergenic
973912352 4:55593666-55593688 CACAAACACAACAGAATATATGG - Intergenic
974174096 4:58304156-58304178 CTCATACAAGAAAGAATTCAGGG - Intergenic
974179426 4:58364465-58364487 CTCACACAAGAAAGAATTCAGGG + Intergenic
974800381 4:66810246-66810268 CTTAAACATAAAAGAATTCTTGG + Intergenic
974957345 4:68657853-68657875 CACACACACAAAAGATTCTATGG - Intronic
975356151 4:73406907-73406929 CTCTATCACAAAAGAAACAATGG - Intronic
975587411 4:75964260-75964282 CACAAACACATAAGAATGAAAGG + Intronic
975781814 4:77848196-77848218 CTCACACAAGAAAGAATGCAGGG + Intergenic
975834174 4:78404194-78404216 CTCAATCTCAAAATAATTCATGG + Intronic
977442244 4:97082919-97082941 AAGAAACACAAAAAAATCCATGG - Intergenic
977499702 4:97823600-97823622 CTCACACAAAAAAGAATTCAAGG - Intronic
977531390 4:98204538-98204560 CTCAGAGACACAAGAATACAGGG - Intergenic
977919993 4:102632425-102632447 TTCAAACACAAAACAATACATGG + Intronic
978108982 4:104938910-104938932 TTCAGACACAATTGAATCCAGGG - Intergenic
978942529 4:114454061-114454083 CTCGCACAAAAAAGAATTCAGGG + Intergenic
979660679 4:123250791-123250813 CTCAATGAAAAAAGAAGCCAAGG - Intronic
980364624 4:131785402-131785424 CTCACACACAAAATAATTCCAGG + Intergenic
981541596 4:145852114-145852136 GACAAACACAAAAGAATACTAGG + Intronic
982265796 4:153537337-153537359 CTCACACAAGAAAGAATTCAAGG + Intronic
983396126 4:167198004-167198026 ACCAAACACAAAAGAATAGAAGG - Intronic
984096749 4:175444298-175444320 CTCACACAAGAAAGAATTCAGGG + Intergenic
984184908 4:176532124-176532146 CTCAAATACAAGAAAACCCATGG - Intergenic
984507598 4:180639161-180639183 CTCACACAAGAAAGAATTCAGGG + Intergenic
984650817 4:182268948-182268970 CTCACACAAGAAAGAATTCAGGG - Intronic
985085368 4:186307773-186307795 CTCAAACCCACAAAACTCCAAGG + Intergenic
985632442 5:1021197-1021219 CTCAAACCCAGAAGAACCGATGG + Intronic
986252623 5:6074511-6074533 CTCACACAAGAAAGAATTCAAGG + Intergenic
986595867 5:9421022-9421044 AACAAACAAAAAAGAATTCATGG + Intronic
988131325 5:27110344-27110366 GTCACACAAGAAAGAATCCAGGG + Intronic
988637154 5:32996789-32996811 ATCAAAAACAAAAGACTGCATGG - Intergenic
988786673 5:34571533-34571555 CTCAAAAACATAAGAATCTGAGG - Intergenic
988831409 5:34990809-34990831 CTCACACAAGAAAGAATTCAGGG - Intergenic
989036068 5:37173299-37173321 CTCCTACTCAAAAGTATCCAAGG - Intronic
989074146 5:37544755-37544777 CTCACATCCAAATGAATCCAAGG - Intronic
989172534 5:38487048-38487070 GTCAAACACAACAAAATCCCAGG + Intronic
989506250 5:42230289-42230311 CACAAATATAAAAGGATCCATGG - Intergenic
990744321 5:58943128-58943150 CTATAACACAAAGGAATTCAAGG - Intergenic
991071512 5:62487392-62487414 CTCAAAAAAAAAAGAATCTTGGG + Intronic
991297810 5:65100224-65100246 CTCACACAGGAAAGAATTCAAGG + Intergenic
992993927 5:82314009-82314031 CACACACACAAAAGAATCCTTGG - Intronic
993315968 5:86406633-86406655 CCCACACAACAAAGAATCCATGG + Intergenic
993450609 5:88069111-88069133 CTCTCACACAAAAGAATGAAAGG + Intergenic
993476100 5:88366563-88366585 CTCACACAGAAAGGAATTCAAGG - Intergenic
993484147 5:88461808-88461830 ATTAAAAACAAAAAAATCCAGGG - Intergenic
993998703 5:94752716-94752738 CACAAACACAAAAACATCCAAGG + Intronic
994194341 5:96905870-96905892 AACAAACAAAAAAGAATCAAAGG + Intronic
994448373 5:99907467-99907489 ATCAAAAAGAAAAAAATCCAAGG + Intergenic
995341141 5:111061175-111061197 CTATGACACAAAAGAATCCATGG + Intergenic
996031810 5:118713608-118713630 CTAAAAAAAAAAAGAATACAAGG + Intergenic
996293245 5:121879573-121879595 CTCATACAAGAAAGAATTCAGGG + Intergenic
997099404 5:130952494-130952516 CTCACACAAGAAAGAATTCAAGG + Intergenic
999023466 5:148197419-148197441 CTCAAACTCAAATGCCTCCAAGG + Intergenic
999592619 5:153165455-153165477 GTCATTCACAAAAAAATCCATGG + Intergenic
999624049 5:153501528-153501550 CTCAAACACTAAAGAACCCATGG + Intronic
999985929 5:157005382-157005404 CACAAGTACAAAAGAATGCAGGG + Intergenic
1000551343 5:162668834-162668856 CTGAAACACAAAAAAATACATGG - Intergenic
1000591162 5:163159088-163159110 GTCAGACACAAAATAATACATGG - Intergenic
1002528668 5:179830395-179830417 TTCAAAAACAAAAGAATTCTAGG - Intronic
1004122339 6:12836397-12836419 CAAATACTCAAAAGAATCCAAGG - Intronic
1004158574 6:13192966-13192988 TTCAAACACTACAGAATACAGGG - Intronic
1004366906 6:15020486-15020508 CTCACACAAGAAAGAATCCGGGG - Intergenic
1004504782 6:16238870-16238892 CTCAAACACCAAAGCAGGCAGGG - Intronic
1004707027 6:18134209-18134231 CTCAAGCACACAGGCATCCAAGG - Intronic
1004831357 6:19479940-19479962 CTCAAACAAATAAAAATCAAAGG + Intergenic
1005022248 6:21429553-21429575 CACACACACAAAAAAAGCCACGG + Intergenic
1005973139 6:30777203-30777225 CTCAAAAAAAAAAGTATCCCTGG - Intergenic
1006524901 6:34595954-34595976 TGCAAACACAGAAGAATACAGGG + Intronic
1007051747 6:38838397-38838419 CTCAAAAAAAAAAGAAGGCAAGG - Intronic
1007804502 6:44430348-44430370 CTCAAACTCACAGTAATCCAAGG - Intronic
1008559532 6:52710224-52710246 CTCACACAAGAAAGAATTCAGGG - Intergenic
1009003641 6:57752652-57752674 CTTAAAGACAAAAGAAGCCAAGG + Intergenic
1009313438 6:62187659-62187681 CACACACACAAAAGAACACAGGG - Intronic
1009701325 6:67185723-67185745 CTGAAACAAAAGAGAACCCAGGG + Intergenic
1010189767 6:73183092-73183114 TTCTCACACAAATGAATCCAAGG - Intronic
1010716196 6:79233426-79233448 CTCACACACAAATTAGTCCATGG + Intronic
1010923043 6:81708140-81708162 CTCACACAAAAAAGAATTCGAGG + Intronic
1011257346 6:85436531-85436553 TTCACACAAGAAAGAATCCAAGG - Intergenic
1011757573 6:90518526-90518548 CCCAAACTCCAAAGAATCTATGG - Exonic
1011949205 6:92943174-92943196 CACAAACACAAAAGAACCGCTGG - Intergenic
1012378853 6:98595597-98595619 CTCAAACATAAAAGAATTCATGG - Intergenic
1012777444 6:103515902-103515924 ATCAAATAGAAAAGGATCCATGG - Intergenic
1013951244 6:115784374-115784396 CTGAAGCAAAAAAGAATGCATGG + Intergenic
1014156192 6:118112538-118112560 CTCACACAAGAAAGAATTCAGGG - Intronic
1014399692 6:120972688-120972710 CACAAACACATTAAAATCCAGGG - Intergenic
1014759285 6:125337982-125338004 CTATAAAATAAAAGAATCCAGGG - Intergenic
1015380888 6:132567232-132567254 AACAAAAACAATAGAATCCAAGG + Intergenic
1015448292 6:133333673-133333695 GTCTAACACCAAAGAATCCCTGG + Intronic
1016006335 6:139092709-139092731 CTCACACAAGAAAGAATTCAAGG - Intergenic
1016278487 6:142383624-142383646 TTGAAATACAAAAGACTCCAAGG - Intronic
1016312422 6:142748111-142748133 CTCAAAAAAATAAAAATCCATGG + Intergenic
1016394316 6:143606022-143606044 CTGAAACACAACTGACTCCAAGG - Intronic
1017442824 6:154479505-154479527 CTCAAGCACAAAAGAAAGCGGGG + Intronic
1017652405 6:156595532-156595554 CTCAAAGAAAAAAAAATTCATGG + Intergenic
1018077188 6:160228140-160228162 CTCACACATGAAAGAATTCAGGG - Intronic
1018357246 6:163030557-163030579 CTCACACAAGAAAGAATTCAGGG + Intronic
1018539325 6:164861238-164861260 CTCAGATACAAAAAAATCCATGG + Intergenic
1019426481 7:979732-979754 CTCAAAAAAAAAAAAATGCAGGG + Intergenic
1020192696 7:6012556-6012578 CTCAAAAACAAAAAAAACCTCGG - Intronic
1021544756 7:21800719-21800741 CCCAAAGAGAAAAGAATCCGTGG + Intronic
1021701029 7:23319647-23319669 ATCAAACACAACAGAACTCAAGG + Intronic
1021928536 7:25556466-25556488 CAAATAAACAAAAGAATCCAAGG + Intergenic
1022582478 7:31569676-31569698 CTCAACCCCAAATGAAACCAAGG - Intronic
1022747238 7:33184767-33184789 CTCAAACAAGAAAGAATTCAGGG + Intronic
1023542121 7:41276725-41276747 CTGAAAAAAAAAAGAATCAATGG + Intergenic
1023568321 7:41547104-41547126 CTCACACAAGAAAGAATTCAGGG + Intergenic
1024657331 7:51462239-51462261 TTCAAAAACAAAAGGCTCCAGGG + Intergenic
1025735853 7:64146145-64146167 CTCAAAAAAAAAAGAATTGAGGG - Intronic
1025789624 7:64677169-64677191 CTCAAAAAAAAAAAAATCCATGG - Intronic
1025923303 7:65935309-65935331 CTCAAAAAAAAAAGAAACCATGG - Intronic
1026097923 7:67361555-67361577 CTCACACAAGAAAGAATTCAGGG - Intergenic
1026119171 7:67521673-67521695 CTCACACAAGAAAGAATTCAGGG - Intergenic
1026306620 7:69148015-69148037 CTCACACAAGAAAGAATTCAGGG + Intergenic
1026823347 7:73564727-73564749 AGCAAACAAAAAAGAACCCAGGG - Intergenic
1026861338 7:73791997-73792019 CTCACACAAGAAAGAATTCAGGG - Intergenic
1026984953 7:74548905-74548927 CTCAAAAACAAAAAAAACCAGGG + Intronic
1027516539 7:79148643-79148665 CTCAAGCACAAACACATCCATGG - Intronic
1028127189 7:87126820-87126842 CCCAAATAGAAAAGAATACAAGG + Intergenic
1029282099 7:99442095-99442117 CTAAATCACAAAAGATTCCTTGG - Intronic
1029362556 7:100098031-100098053 CCCAAACAAAACAGAACCCAGGG - Intronic
1029834442 7:103295025-103295047 CTCAAACATGAAAGAATTAAAGG + Intergenic
1029855499 7:103511960-103511982 CACACACACAAAAGAATACAAGG - Intronic
1030094608 7:105886997-105887019 CTCATATACAAAAGAAACCTTGG - Intronic
1030316266 7:108117604-108117626 CTCACACAAGAAAGAATTCAGGG + Intronic
1030641908 7:112015507-112015529 CTCAAGCAAGAAAGAATTCAGGG - Intronic
1031533683 7:122908055-122908077 CTCACACAAGAAAGAATTCAGGG + Intergenic
1032576107 7:133056711-133056733 CTTTAACACAGAAGCATCCAGGG - Intronic
1032670964 7:134082057-134082079 CTCACACAAGAAAGAATTCAGGG + Intergenic
1032975306 7:137215991-137216013 CTCAAAAAAAAAAGAATACTGGG + Intergenic
1033351556 7:140566380-140566402 CTCACACAAGAAAGAATTCAGGG - Intronic
1033577951 7:142704269-142704291 CTCAAGCAAGAAAGAATTCAGGG - Intergenic
1033903881 7:146177047-146177069 GTGAAAGACAACAGAATCCATGG - Intronic
1034060872 7:148087590-148087612 CTAAAACACTAAAAAATCAATGG - Intronic
1034223407 7:149462117-149462139 CTCAAAAACAAAATGACCCATGG - Intergenic
1034249984 7:149681806-149681828 CTCACACAAGAAAGAATTCAGGG + Intergenic
1036437961 8:8753000-8753022 CTCAAAAAAAAAAAAATCAAAGG + Intergenic
1036459211 8:8937054-8937076 CTCACACAAGAAAGAATTCAGGG - Intergenic
1036459823 8:8942189-8942211 CTCCAGCAAAAAAGAATTCAGGG + Intergenic
1038390525 8:27195190-27195212 CCCTAACAGAAAAGAGTCCACGG + Intergenic
1038613379 8:29072726-29072748 TTCATACAAAATAGAATCCAGGG + Intronic
1038623537 8:29168346-29168368 CTCAAGCACAAAAGAAGACTTGG + Intronic
1038832011 8:31072389-31072411 TTCAAACAGAGAAGAGTCCACGG + Intronic
1040530528 8:48263089-48263111 CTCAAACACAAAAATCTCCCAGG - Intergenic
1041404373 8:57482225-57482247 CTCAAACACAGAACACTCCAAGG - Intergenic
1041774480 8:61509210-61509232 CTCAAACAAGAAAGAATTCAGGG + Intronic
1041802849 8:61818747-61818769 CTAGAACACAAAAGAGTCCTTGG - Intergenic
1042515656 8:69656045-69656067 TTGAAACACACAAGAATGCAGGG - Intronic
1043327923 8:79075752-79075774 CTCAACCACTAAAAAATTCAGGG + Intergenic
1044920828 8:97167653-97167675 CCCAAACACAAAAGGACCCCTGG - Intergenic
1044986857 8:97763486-97763508 CTCACACAAGAAAGAATTCAAGG - Intergenic
1045428091 8:102087160-102087182 CTCACACAAGAAAGAATTCAGGG - Intronic
1045624600 8:104028841-104028863 CTCAAACAAGAAAGAATTCAAGG + Intronic
1045895159 8:107207345-107207367 CTCAAATACAACAGAAACCCAGG - Intergenic
1046124887 8:109893314-109893336 ATAAAACAGAAAAGAATTCAGGG - Intergenic
1046154821 8:110274561-110274583 AACAAACACAAAAGAACACAAGG + Intergenic
1046768008 8:118091020-118091042 CTGAAACACCAAAGAAGTCAAGG + Intronic
1047124547 8:121946269-121946291 CACACACACAAAAGAAACAAAGG + Intergenic
1047526724 8:125640400-125640422 CTCACACAAGAAAGAATTCAGGG - Intergenic
1047793446 8:128229863-128229885 CTCAAGCATGAAAGAATCCAGGG - Intergenic
1048324434 8:133428301-133428323 CTCACACAAGAAAGAATTCAGGG - Intergenic
1048329474 8:133462259-133462281 CTGACACACAGAAAAATCCAAGG + Intronic
1049736755 8:144211762-144211784 TAAAAACACAAAAGAATCAAGGG - Intronic
1049914534 9:304567-304589 ATCAACCATAAAAGAAACCAAGG + Exonic
1050671314 9:8000533-8000555 TTTAAACAGAAAAGAACCCAAGG - Intergenic
1051974477 9:22933081-22933103 CTCACACAAGAAAGAATTCAGGG + Intergenic
1052891433 9:33704095-33704117 CTCAAGCAAGAAAGAATTCAAGG - Intergenic
1053012775 9:34644467-34644489 CTCACACAAGAAAGAATTCAAGG - Intronic
1053249047 9:36559231-36559253 CTCACACAAGAAAGAATTCAGGG + Intergenic
1053777041 9:41554752-41554774 CTCACACACAAAATAATTCCAGG - Intergenic
1053812436 9:41867104-41867126 TTGAAACACAAAGGAATCTAAGG + Intergenic
1054364689 9:64323732-64323754 CTCACACACAAAATAATTCCAGG + Intergenic
1054618159 9:67320335-67320357 TTGAAACACAAAGGAATCTAAGG - Intergenic
1055442665 9:76352017-76352039 CTCACACAAGAAAGAATTCAGGG + Intronic
1056683854 9:88743569-88743591 CTCAAACAAATTAGAGTCCAGGG - Intergenic
1056700705 9:88904240-88904262 CTCAGACAATAAAGAATCAAGGG - Intergenic
1056729452 9:89152984-89153006 ATCAAATACAAAAGAACTCAGGG + Intronic
1057364041 9:94401771-94401793 CTCGAACAAGAAAGAATTCAGGG + Intronic
1057557369 9:96098664-96098686 CTCAAAAACAAATGAAACAAAGG + Intergenic
1057659296 9:96986290-96986312 CTCGAACAAGAAAGAATTCAGGG - Intronic
1057793510 9:98139793-98139815 CTCAAACAAAAAACAAAACACGG + Intronic
1059986866 9:119828872-119828894 TTCTAACATAAAAGAATCGAGGG + Intergenic
1060201864 9:121656006-121656028 CTCAAAAAAAAAAAAAGCCAGGG - Intronic
1061027534 9:128059863-128059885 CTCAAAAACAAAAAAAACCATGG - Intergenic
1061049112 9:128183640-128183662 CTCAAACACACAAGGAGCCAGGG + Intronic
1061650350 9:132042966-132042988 CTCAAAAACAAAAGTACCTATGG - Intronic
1203611073 Un_KI270749v1:4719-4741 CTCACACAGGAAAGAATTCAAGG - Intergenic
1185473875 X:401906-401928 AACAAACAAAAAAGAATACACGG - Intergenic
1185546279 X:948100-948122 ATCTAAAACAAAGGAATCCATGG + Intergenic
1186165648 X:6823590-6823612 CTCACACAAGAAAGAATTCAGGG + Intergenic
1186559719 X:10598458-10598480 CTGTAACACAACACAATCCAAGG - Intronic
1187220860 X:17324529-17324551 CTCACACAAGAAAGAATTCAGGG + Intergenic
1188206559 X:27366489-27366511 CACAAAAAGAAAAAAATCCAAGG + Intergenic
1188234781 X:27714797-27714819 CTCAAACCTGATAGAATCCAGGG - Intronic
1188256409 X:27966578-27966600 GACAAACCCAAAAAAATCCAAGG + Intergenic
1188284389 X:28310543-28310565 CTCACACAAGAAAGAATTCAGGG - Intergenic
1188913091 X:35874715-35874737 CTAAAACACAGAAGCAGCCAAGG + Intergenic
1189419548 X:40844590-40844612 CTCACACAGGAAAGAATTCAGGG - Intergenic
1189565203 X:42234723-42234745 CTCAAAAAAAAAAAAATTCAAGG - Intergenic
1190137917 X:47813938-47813960 CTCACACAAGAAAGAATTCAGGG + Intergenic
1190599911 X:52080237-52080259 ATCAAACAAAAAAGAATCAGTGG + Intergenic
1190870095 X:54417637-54417659 CTCAAACAAATAAAAATTCAGGG - Intergenic
1190921059 X:54852656-54852678 CTCACACAAGAAAGAATTCAGGG + Intergenic
1191119345 X:56887383-56887405 CTCACACAGGAAAGAATTCAGGG - Intergenic
1191176934 X:57514179-57514201 CTCAAAAACATAAAATTCCATGG - Intergenic
1192048453 X:67700928-67700950 ATTACACACAAATGAATCCATGG - Intronic
1192468130 X:71372637-71372659 CTCAAAAAAAAAAAAATACAGGG + Intronic
1192936627 X:75866175-75866197 CTCAAAAAAAAAAAAAGCCAAGG - Intergenic
1193526599 X:82598336-82598358 CTCAAAGGCAAAAGATTCCTGGG - Intergenic
1194267084 X:91767606-91767628 CTCACACAAGAAAGAATTCAGGG + Intergenic
1195335636 X:103850986-103851008 ATCAAACACAAAAGAGTACATGG - Intergenic
1198661876 X:138978261-138978283 CTCAAAAAAAAAAAAAACCAGGG - Intronic
1198977745 X:142356034-142356056 CTAAAATACAAAACAATCTAAGG - Intergenic
1199970539 X:152857051-152857073 ATAAAATAAAAAAGAATCCATGG + Intronic
1200035890 X:153330063-153330085 CTCAAGGAAAAAAGCATCCAAGG - Intergenic
1200584287 Y:4988545-4988567 CTCACACAAGAAAGAATTCAGGG + Intergenic