ID: 968149783

View in Genome Browser
Species Human (GRCh38)
Location 3:196328004-196328026
Sequence AAGAAGTAATATTGTCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968149781_968149783 -5 Left 968149781 3:196327986-196328008 CCACACAGATAGGAAAGAAAGAA 0: 1
1: 2
2: 5
3: 92
4: 841
Right 968149783 3:196328004-196328026 AAGAAGTAATATTGTCGGCCAGG 0: 1
1: 0
2: 3
3: 39
4: 306
968149778_968149783 28 Left 968149778 3:196327953-196327975 CCAGTGCAATACGAAAATAAAAG 0: 1
1: 0
2: 4
3: 44
4: 415
Right 968149783 3:196328004-196328026 AAGAAGTAATATTGTCGGCCAGG 0: 1
1: 0
2: 3
3: 39
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968149783 Original CRISPR AAGAAGTAATATTGTCGGCC AGG Intronic
901688284 1:10956770-10956792 AAAAAGTAAAATCATCGGCCGGG - Intronic
901928328 1:12581120-12581142 AAAAAGTTATATTGTTGGCTGGG - Intronic
904693819 1:32315669-32315691 AAGTAATAATTTTGTAGGCCGGG + Intronic
904705781 1:32389655-32389677 AAGAAGTATTGATGTGGGCCAGG + Intronic
904731531 1:32595951-32595973 AAGAAGTAAAATGATGGGCCAGG - Intronic
905062463 1:35151292-35151314 AAGAACAAATATTGGAGGCCGGG - Intergenic
906069525 1:43007100-43007122 AAAAAGCAGTCTTGTCGGCCGGG - Intergenic
907022586 1:51082950-51082972 AAGAATTAATATTGTTGGCTGGG - Intergenic
908004369 1:59712746-59712768 AAAAAGTGATGTTGTGGGCCGGG - Intronic
908388606 1:63665383-63665405 AAGATTTAACATTGTTGGCCAGG - Intergenic
909616531 1:77616567-77616589 AAAAATTAAAATTGTCAGCCGGG + Intronic
910138703 1:84001565-84001587 AAGAAGTACTACTTTAGGCCTGG + Intergenic
911066004 1:93789165-93789187 AATATGTAAAATTGTTGGCCAGG + Intronic
911580273 1:99625944-99625966 AAAAAGTAATATTGCCGGCTGGG + Intergenic
911646969 1:100347986-100348008 AAGAAAGAATATTTTCCGCCAGG + Intergenic
911904360 1:103548096-103548118 AAAAAGTGATTTTGTGGGCCGGG - Intronic
912352468 1:109027349-109027371 AAGAATTAAAATTCTGGGCCAGG - Intronic
914238222 1:145831744-145831766 AAGAAAAAATGGTGTCGGCCAGG + Intronic
915130809 1:153694213-153694235 AAGAATTATTATTATTGGCCGGG + Intergenic
916577152 1:166078322-166078344 AATAACTAATATTGACGGCCAGG - Intronic
917278732 1:173358407-173358429 AAGAAAAAATATTGTCTGCAAGG + Intergenic
918120591 1:181535980-181536002 AAGAAATAATCATGTTGGCCAGG - Intronic
919015336 1:192026347-192026369 AAGAAGTAATATTGTTAGAATGG - Intergenic
919329269 1:196148227-196148249 AATCAGAAATATTGCCGGCCGGG - Intergenic
920329451 1:205195120-205195142 TAGAAGTGATATTTTTGGCCAGG - Intronic
920768221 1:208853904-208853926 AAGAAGTTAAATTTTAGGCCAGG - Intergenic
921310009 1:213833269-213833291 AAGAAGTGCTACTGTGGGCCAGG + Intergenic
921607414 1:217172007-217172029 AAGAAGAAATTGTTTCGGCCAGG - Intergenic
922486506 1:225977252-225977274 AAAAAATAAAACTGTCGGCCAGG + Intergenic
922487305 1:225984513-225984535 TAAAAGTTATATCGTCGGCCAGG + Exonic
922992340 1:229924955-229924977 AAGCAGTAATAATGTCGACCTGG + Intergenic
924506977 1:244695356-244695378 TAAAATTAATATTTTCGGCCAGG + Intronic
1063221400 10:3971728-3971750 AAAAACTAATAATGTTGGCCGGG - Intergenic
1065791930 10:29268472-29268494 AAAAAATAATACTGTTGGCCGGG + Intergenic
1066002807 10:31119996-31120018 AAAAAGTAAAAATGTTGGCCAGG - Intergenic
1066579943 10:36869807-36869829 AAGAATTCAACTTGTCGGCCGGG + Intergenic
1067126418 10:43519758-43519780 AAGAACTAACATTTTAGGCCAGG - Intergenic
1069040776 10:63693686-63693708 AAAAAGTTATTTTGTGGGCCAGG + Intergenic
1069069978 10:63983164-63983186 AAGAAGTTGTATTGTGGGCCGGG + Intergenic
1069455789 10:68552727-68552749 AAAAAGCAATAGTTTCGGCCGGG - Intergenic
1069795571 10:71049711-71049733 AAGAAGTAAGTTTGTGGGCAGGG + Intergenic
1070320201 10:75348805-75348827 AAAAAGTAATAGGGGCGGCCGGG - Intergenic
1070623496 10:78032168-78032190 AAAAAGAAAAATAGTCGGCCGGG + Intergenic
1071613754 10:87055818-87055840 AAGGAGATATATTGACGGCCGGG + Intronic
1072589760 10:96818686-96818708 AAAAAGTAAAATAGTTGGCCAGG - Intergenic
1073172892 10:101527455-101527477 AACAAAGAATATTGTTGGCCGGG + Intronic
1077731896 11:4740385-4740407 AAGAAATAATATTTTGGGGCTGG + Intronic
1080142811 11:28942906-28942928 AAGAAGAAACATGGCCGGCCAGG - Intergenic
1081066522 11:38548045-38548067 AAAAAGTAATATTAAAGGCCGGG + Intergenic
1082127184 11:48447188-48447210 AAAAAGAAAACTTGTCGGCCAGG - Intergenic
1084100285 11:66943441-66943463 AAGAAATAAACTTCTCGGCCGGG + Intronic
1084994733 11:72965082-72965104 AAGAAGTAAAATGATTGGCCAGG - Intronic
1085575075 11:77595628-77595650 AAGAAATAATATGGCCGGGCAGG + Intronic
1086983816 11:93227033-93227055 AAAAAGTAATTGTGTAGGCCGGG - Intergenic
1087015725 11:93552765-93552787 TAAAAGTAATAATGTGGGCCAGG - Intergenic
1088429565 11:109744051-109744073 AAGAAGTAGTTTTGTCAGGCTGG + Intergenic
1089239536 11:117064854-117064876 AGAAAGTAACTTTGTCGGCCAGG + Intronic
1089377899 11:118007687-118007709 AAGAAGTCACATCTTCGGCCGGG - Intergenic
1089716100 11:120360686-120360708 AAAAAGTAATATTACTGGCCAGG - Intronic
1089768004 11:120782578-120782600 AAAAAGTCATACTGGCGGCCAGG - Intronic
1091065666 11:132509507-132509529 AAAAAGTGATTTTGTGGGCCAGG + Intronic
1091916919 12:4276269-4276291 TAGAAGGCATATTGTTGGCCAGG - Intronic
1092184341 12:6467732-6467754 AAAAAGTTATTTTGTGGGCCAGG + Intronic
1092326244 12:7534469-7534491 AAAAAGTAGTTTTGTGGGCCAGG + Intergenic
1092788763 12:12053708-12053730 AAGAAGTTATATTGCCGGCTGGG - Intronic
1093263395 12:16969414-16969436 AAAAAATACTATTGTCAGCCGGG - Intergenic
1095771239 12:45960376-45960398 AAGAAATAATATTGTTGGATGGG - Intronic
1097864511 12:64548483-64548505 AAGAAGTAAAATTGTTGGCCAGG - Intergenic
1100249902 12:92808589-92808611 AAGAAGTGATCTTCTCAGCCTGG - Intronic
1100510573 12:95268198-95268220 AATAAGTAATATTTCCGGCCGGG + Intronic
1102066087 12:109976882-109976904 AAGCTGTAACATTGTCAGCCAGG - Intronic
1102355080 12:112227162-112227184 AAGAAGTGTCATTGTTGGCCGGG + Intronic
1102829643 12:115985688-115985710 AAGATGTAAAATTATCTGCCTGG + Intronic
1102893379 12:116579388-116579410 AAGAAGTATGATTCTAGGCCAGG + Intergenic
1104407552 12:128530736-128530758 AAGAAGTGTTATTGGAGGCCGGG - Intronic
1105382940 13:19904259-19904281 AAAAAATAATACTGTTGGCCGGG + Intergenic
1106501242 13:30330894-30330916 AAGAATTTATACTGGCGGCCGGG - Intergenic
1106678928 13:31989978-31990000 AAGAAACCATAATGTCGGCCGGG - Intergenic
1107949782 13:45451612-45451634 ATGAAGTAGTATTCTGGGCCAGG + Intergenic
1108183660 13:47866910-47866932 AATATGTAATACTTTCGGCCTGG - Intergenic
1108276505 13:48815768-48815790 AAAAAGTAAAATTCTGGGCCAGG + Intergenic
1108644105 13:52409248-52409270 AAGAACTTATATTGTCAGCCAGG + Intergenic
1109407356 13:61919048-61919070 AAAAAGTAGTTTTGTGGGCCAGG - Intergenic
1110874077 13:80488200-80488222 AAGAAGCAATCATGTTGGCCAGG + Intergenic
1111540733 13:89664302-89664324 AATAAGTAAAATTGTTGGCTAGG - Intergenic
1112454017 13:99541852-99541874 AAGAATTAATATTCTTGGCTGGG + Intronic
1112952505 13:105017814-105017836 AAGAACTAATATTTTGGCCCAGG - Intergenic
1113494702 13:110717529-110717551 TACAAGTAGTATTGTTGGCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114387640 14:22271347-22271369 AAAAAATAATCTTGTTGGCCAGG - Intergenic
1115405780 14:33014674-33014696 AAGAAGTAATATTATTACCCAGG - Intronic
1116439787 14:44938663-44938685 AAGACTTAATGTTTTCGGCCGGG - Intronic
1116677966 14:47929853-47929875 TAAAATTAATATTCTCGGCCGGG + Intergenic
1117363612 14:55002885-55002907 AAGAAGTAGTATTGAAGGTCAGG - Intronic
1118185455 14:63533646-63533668 AAGAAATAACAATGGCGGCCGGG + Intronic
1118252880 14:64179434-64179456 AAAAAGTTACATTGTAGGCCAGG - Intronic
1118664851 14:68056781-68056803 AATAAGAAATATTTACGGCCAGG + Intronic
1118667118 14:68082253-68082275 AAGAAATATTATTTGCGGCCGGG - Intronic
1119256391 14:73201379-73201401 AAAAAATGATATTCTCGGCCAGG - Intronic
1119597321 14:75947195-75947217 AAATAGTTATATTGTCAGCCTGG + Intronic
1120055875 14:79923603-79923625 AAGAAGAAATAATGTAGACCTGG - Intergenic
1120324076 14:83003278-83003300 AAAAAATAATATTTTCGGCCGGG - Intergenic
1121082735 14:91121391-91121413 AAGAAATAATATTTTTGGCTGGG + Intronic
1122911527 14:104830791-104830813 AAGAAAAACTATTCTCGGCCGGG - Intergenic
1124446147 15:29734779-29734801 AAGATGTGATATTTTCGGCCGGG - Intronic
1126759804 15:51959297-51959319 AAGAAGTAAAATTACTGGCCGGG - Intronic
1128958053 15:71970861-71970883 AATAAGTGACATTCTCGGCCGGG + Intronic
1130366085 15:83240578-83240600 AAGAAGTGAAATTGTCGTTCTGG + Intergenic
1130793871 15:87187969-87187991 AAGAAGAAAAAATGTGGGCCAGG + Intergenic
1131331115 15:91500350-91500372 AAGAATTAAAATTTTTGGCCGGG + Intergenic
1135057741 16:19244628-19244650 AAGAAGTAAGATTCTGGTCCAGG - Intronic
1135088618 16:19494511-19494533 AAAAAGTAATATTCATGGCCAGG + Intronic
1136523969 16:30815879-30815901 AAGTAATAATATAGTAGGCCAGG + Intergenic
1137034147 16:35554500-35554522 AAGAAATACTATTGCAGGCCAGG - Intergenic
1138053741 16:53811001-53811023 AGGAAGTAATCCTGTTGGCCTGG + Intronic
1138238774 16:55409126-55409148 AGGAAGTAGTAGTGTCTGCCTGG + Intronic
1138465047 16:57183626-57183648 AAGAATTAATATTTTTGGCTGGG - Intronic
1138993830 16:62424048-62424070 ATAAAGAATTATTGTCGGCCGGG - Intergenic
1139622107 16:68153907-68153929 AAAAAATAATAATGTGGGCCGGG - Intronic
1141007525 16:80366402-80366424 AAGAATTAATATTTGAGGCCGGG + Intergenic
1141021612 16:80502147-80502169 AAGAAGTAAGATTGCAGGCAAGG + Intergenic
1141270168 16:82532370-82532392 AAGAAGTAGTATTCTCTCCCAGG + Intergenic
1141496228 16:84411735-84411757 AAGAATTTAGTTTGTCGGCCGGG - Intronic
1141902899 16:87004185-87004207 AAGAGTTAATTTTGTCGGCCGGG - Intergenic
1142859899 17:2755317-2755339 AAGAAGTAAACTACTCGGCCGGG - Intergenic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1143159897 17:4862706-4862728 AAAAAATAATATTGACAGCCTGG - Intronic
1144209991 17:13006073-13006095 AAAAAATAATAATGTTGGCCAGG + Intronic
1144477447 17:15600752-15600774 AAGATAATATATTGTCGGCCGGG + Intronic
1144595309 17:16565057-16565079 AAAAAGTCATATTGGAGGCCAGG + Intronic
1144869821 17:18362617-18362639 CAGAAATAACATTGTAGGCCGGG - Intronic
1144920793 17:18762615-18762637 AAGATAATATATTGTCGGCCGGG - Intronic
1149780056 17:59390295-59390317 AAGAAATAAATTTGTTGGCCAGG - Intronic
1149878962 17:60268104-60268126 AAGAGTTAAAATTGTTGGCCGGG - Intronic
1149930053 17:60742816-60742838 AAATTGTAATATTTTCGGCCAGG + Intronic
1150918899 17:69462797-69462819 AAGAAGTCATGTTTTTGGCCGGG + Intronic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151580676 17:74976410-74976432 AAGAAAGAATATTCTCGGCCGGG + Intergenic
1151699444 17:75735380-75735402 AAGAAATAAAACTGTCAGCCGGG - Intronic
1151994929 17:77602499-77602521 AAGAAGGAATAGTGGGGGCCGGG + Intergenic
1152402385 17:80075258-80075280 AAAAAGTAATATTTTGGGCCAGG - Intronic
1153219944 18:2852812-2852834 AAGAATTATTATTGCGGGCCAGG - Intronic
1154977611 18:21474711-21474733 AAAAAGTATTTTTGTGGGCCAGG - Intronic
1156547961 18:37984514-37984536 AAGAGGTAAAATTGATGGCCTGG - Intergenic
1156564879 18:38176467-38176489 ATTAAGAAATATTGTGGGCCGGG + Intergenic
1157130993 18:45007171-45007193 AGGAAGAGATATTGTGGGCCAGG - Intronic
1157467987 18:47964819-47964841 GAGAAGGAAAATTGTCAGCCTGG - Intergenic
1158069343 18:53452282-53452304 AAGCAGTTATATGGTAGGCCAGG - Intronic
1158192220 18:54843089-54843111 AAAAAATAATATTATTGGCCAGG - Intronic
1160176206 18:76597143-76597165 AAAAAGTGAAAGTGTCGGCCAGG + Intergenic
1161099117 19:2411845-2411867 AAAAATTATAATTGTCGGCCGGG - Intronic
1161763842 19:6195353-6195375 TAAAAGTGAAATTGTCGGCCGGG + Intronic
1162999777 19:14359568-14359590 AATATGTAATATTGTGGGTCTGG - Intergenic
1163482596 19:17566816-17566838 AAAAAGTAAAATAGTAGGCCAGG + Intronic
1163840748 19:19608055-19608077 AAGAAGTAAAACTGCAGGCCGGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1167303157 19:48691320-48691342 AAGAAAAAAAATTGTAGGCCGGG - Intergenic
1167490397 19:49789727-49789749 AAGAAATAAGATGGTGGGCCAGG - Intronic
1167589386 19:50395204-50395226 AAGAATAAATAGTGTAGGCCGGG + Intronic
1167589397 19:50395298-50395320 AAGAATAAATAGTGTAGGCCGGG + Intronic
1168624093 19:57902972-57902994 AAAGAGTAATATTTCCGGCCTGG - Intronic
924972860 2:145907-145929 AAGAAGTAAAAGTGTCTGCTTGG - Intergenic
925076038 2:1016534-1016556 AAGAAATAAAGTTGTCGGCCGGG - Intronic
926623056 2:15065447-15065469 AAGAAGTAAGATTATCTGTCTGG + Intergenic
926736155 2:16074632-16074654 AAAACATAATATTGACGGCCGGG + Intergenic
927541809 2:23919045-23919067 AAAAAGAAAGATTGTCGGCTAGG + Intronic
928754144 2:34503502-34503524 TAGAAGAAATAGTATCGGCCAGG - Intergenic
929722127 2:44380864-44380886 AAGAAATAATGCTTTCGGCCGGG + Intronic
929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG + Intronic
930825813 2:55695848-55695870 AAGGATTAAAAGTGTCGGCCGGG + Intergenic
932189371 2:69726744-69726766 AAGAAGTACTGTTGTGTGCCTGG + Intronic
933414009 2:81961851-81961873 TAAAAGTAATATTTTCGGCCGGG + Intergenic
933979052 2:87535844-87535866 CAGAAGTAAGATTGGGGGCCAGG + Intergenic
936314775 2:111414948-111414970 CAGAAGTAAGATTGGGGGCCAGG - Intergenic
936414882 2:112297816-112297838 AAGAATTAATATTGACTGGCTGG + Intronic
936646151 2:114375292-114375314 AAGAAGTAACAGTGTTGGCTGGG - Intergenic
936994399 2:118398307-118398329 TAGAAGTAGTTTTGTGGGCCAGG + Intergenic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
939489165 2:142856295-142856317 AAGAAGTACTTTTCTTGGCCAGG + Intergenic
941675652 2:168341021-168341043 GAGAATTCATATTTTCGGCCAGG - Intergenic
941923505 2:170874113-170874135 AAAAAGGAATATTGGTGGCCGGG + Intergenic
942950046 2:181712064-181712086 AAAAAATAATTTTGTGGGCCGGG + Intergenic
943223540 2:185140257-185140279 AAAAAATAATATTTTGGGCCAGG - Intergenic
944052396 2:195485440-195485462 AAAAAGTACTATAGTAGGCCAGG + Intergenic
944382042 2:199122231-199122253 AGGAAGTATTATTGCCGGGCTGG + Intergenic
944546353 2:200802733-200802755 AAGAAGTGGAATTGCCGGCCAGG - Intergenic
944624844 2:201560130-201560152 AAAATGTAAAATTGTGGGCCAGG + Intronic
946145607 2:217728667-217728689 AAGCAGTAATATTCTGGGGCTGG + Intronic
947686231 2:232088103-232088125 TAGAAGTATTTTTGTCGGCTGGG + Intronic
1170078964 20:12450563-12450585 AAGAAGTGGGTTTGTCGGCCAGG + Intergenic
1170758134 20:19222995-19223017 AAGAAGTAATACAGAGGGCCAGG + Intronic
1173979814 20:47215075-47215097 TAGAATTAAAAATGTCGGCCAGG + Intronic
1174658111 20:52188610-52188632 ATCAAGAAATAATGTCGGCCGGG - Intronic
1176310934 21:5148470-5148492 AAGAAATGACATTGTTGGCCGGG + Intronic
1176912389 21:14581653-14581675 AAGAAATATTATTTTTGGCCAGG - Intronic
1178847495 21:36185905-36185927 AAAAAGTAATTTTCTGGGCCGGG + Intronic
1179066175 21:38026756-38026778 AAGAAGTAAGAGTGTAGACCTGG - Intronic
1179216792 21:39374407-39374429 ACGAAGAAAGATTGTTGGCCAGG + Intergenic
1179218114 21:39384553-39384575 AAAAAAAAAAATTGTCGGCCAGG - Intronic
1179360341 21:40701031-40701053 AAGAAATAATAATTTTGGCCAGG - Intronic
1179766055 21:43573932-43573954 AAGAAGTCATCTTGTCTGCATGG + Intronic
1179846121 21:44113565-44113587 AAGAAATGACATTGTTGGCCGGG - Intronic
1182720183 22:32391684-32391706 AATACTTATTATTGTCGGCCGGG - Intronic
949335893 3:2975008-2975030 AATAATTAATATTGTCTTCCAGG + Intronic
950696994 3:14708937-14708959 ATGAATTAATATTGTTGGCCGGG - Intronic
950783434 3:15412058-15412080 AAAAAGGAATATAATCGGCCGGG - Intronic
951930179 3:27956222-27956244 AAGAAAAAATAATGTAGGCCAGG - Intergenic
951943073 3:28103423-28103445 AAAAAGTAATATTCTAGGCAAGG + Intergenic
953018128 3:39097653-39097675 AAGAAGAAATATTGTGGTCTGGG + Exonic
954817866 3:53297646-53297668 AAGAATTAGTCTTGTTGGCCAGG - Intronic
955264777 3:57431656-57431678 CATAGGTAATATTGTAGGCCTGG - Intronic
955528655 3:59849073-59849095 AAGAAATAAGATTCTCGGCCAGG + Intronic
955862740 3:63349393-63349415 AAGAATTAATGTTGTTGGCCAGG - Intronic
957327533 3:78715829-78715851 AAAAATTAATTTTGTTGGCCGGG - Intronic
957839909 3:85654517-85654539 AAGAAGCATGATTGTCAGCCAGG + Intronic
957988208 3:87597448-87597470 AAAAAGTGATTTTGTGGGCCAGG - Intergenic
958033864 3:88148215-88148237 AAGAAACTATATAGTCGGCCAGG - Intronic
959229961 3:103635548-103635570 AAGAAATAATAGTGTTGGCAAGG + Intergenic
959342578 3:105149405-105149427 AAAAAGTGATTTTGTGGGCCAGG - Intergenic
960995966 3:123340411-123340433 AAGAAGTATTATTCTGGGCTTGG - Intronic
961941759 3:130645571-130645593 AAGAAATACTATTTTTGGCCAGG - Intronic
962955473 3:140262515-140262537 AAGAAGTAATATTGTTGATGGGG + Intronic
964554044 3:157916207-157916229 AAGAAGTAAAATTGTCCTTCTGG + Intergenic
965568833 3:170150915-170150937 AATAAATAATATTTTTGGCCGGG + Intronic
965661461 3:171046342-171046364 AAAAAGAAATATTCTAGGCCGGG + Intergenic
967007200 3:185395651-185395673 TAGAAATAATATTGAAGGCCGGG - Intronic
968014674 3:195318956-195318978 AAAAAATAGTATTGTGGGCCAGG + Intronic
968149783 3:196328004-196328026 AAGAAGTAATATTGTCGGCCAGG + Intronic
971738478 4:30489667-30489689 AAGAAGTTTTATTTTCGGCTTGG + Intergenic
975130096 4:70824263-70824285 AAGAGGTAATACTGTGGGCTGGG - Intronic
975338666 4:73211549-73211571 AAGAAATCTAATTGTCGGCCAGG + Intronic
976051600 4:81016788-81016810 AAAAAGTAGTTTTGTGGGCCGGG - Intergenic
976920579 4:90437114-90437136 ATGAAATAATATTCTCGTCCGGG - Intronic
978437110 4:108697742-108697764 AAGAACTGATAATCTCGGCCAGG + Intergenic
979847280 4:125531540-125531562 AAAAAGTAAAATTCTAGGCCAGG - Intergenic
980553934 4:134377933-134377955 AAGCAGTATTATTGTCAGCTAGG - Intergenic
980636940 4:135518254-135518276 AAAAATTATTATTGTCGGCTGGG - Intergenic
983579055 4:169289421-169289443 AAGAAAAAATATTCTAGGCCAGG - Intergenic
983611337 4:169648729-169648751 AAGAAGTATGAATGTCAGCCAGG + Intronic
985261226 4:188116789-188116811 AAGATTTAATAATGTGGGCCGGG - Intergenic
985272384 4:188206617-188206639 AAAAATTAACATTGTAGGCCAGG - Intergenic
987046895 5:14116948-14116970 TAAAAGTATTATTGTCGGCTGGG + Intergenic
988964990 5:36407066-36407088 AAGTAGTAAGAGTGTTGGCCTGG - Intergenic
989738157 5:44733523-44733545 TAAAAATAGTATTGTCGGCCAGG + Intergenic
992731249 5:79671805-79671827 AAAAATTACTATTTTCGGCCGGG + Intronic
993698185 5:91086916-91086938 ATGAAGGAATATTGAGGGCCAGG - Intronic
994170773 5:96657799-96657821 AAAATGTAATTTTGTAGGCCAGG + Intronic
994469728 5:100187920-100187942 AAGAAGTATGAATGTTGGCCGGG + Intergenic
995026298 5:107427219-107427241 ATGTAGAAATATTCTCGGCCTGG + Exonic
995036146 5:107536809-107536831 AAGAAGTAGATTTTTCGGCCGGG + Intronic
996556694 5:124785848-124785870 AAAAAATAATAATGCCGGCCAGG - Intergenic
997851551 5:137337308-137337330 AAGAAGTAGTTTTGTCTGCAAGG + Intronic
998085266 5:139316538-139316560 AATAAGTAAAATTTGCGGCCTGG - Intronic
999294758 5:150452111-150452133 AAAATGTACTATTATCGGCCAGG - Intergenic
999409629 5:151339603-151339625 AAAAAGAACTATTGTTGGCCGGG - Intronic
999579349 5:153018620-153018642 TAAAAGTAAAATTGTCGGCCGGG + Intergenic
999871179 5:155753040-155753062 AAGAAGAAATGATCTCGGCCGGG + Intergenic
1001628812 5:173159332-173159354 AAGATTTGATATTTTCGGCCGGG - Intronic
1002396627 5:178961222-178961244 AAAAACTAAGATTGTGGGCCAGG - Intronic
1003854174 6:10255169-10255191 AAAAATTAATATTGTCGGCCGGG - Intergenic
1004618616 6:17313809-17313831 AAGGAGTATGATTCTCGGCCAGG + Intergenic
1005578994 6:27215895-27215917 AAGAAGTAAAGTTCTAGGCCGGG + Intergenic
1005752347 6:28895074-28895096 CAGAAGAAATATTGCTGGCCGGG - Intergenic
1005827018 6:29638859-29638881 AAGAAGTAAGAGAGTAGGCCGGG + Intergenic
1006355442 6:33554206-33554228 AAAAAGTAACATTATGGGCCGGG + Intergenic
1006756204 6:36417900-36417922 AAAAAGTAATTTTGTGGGCAGGG + Intronic
1006976166 6:38104004-38104026 AAAAAGTAATATAGTTGGGCAGG + Intronic
1007037468 6:38689649-38689671 AAGAATTCATATTCTTGGCCAGG + Intronic
1008125458 6:47663510-47663532 AAGAAGTCATCTTCTGGGCCGGG - Intronic
1009886932 6:69634973-69634995 AAGAAATGTTATTGTCGGCCGGG + Intergenic
1010664931 6:78617972-78617994 TAAAAGTAATATTAGCGGCCTGG + Intergenic
1011585421 6:88919612-88919634 TAGAAATAAAATTGTGGGCCAGG - Intronic
1011977060 6:93315155-93315177 AGAAAATTATATTGTCGGCCAGG - Intronic
1015301502 6:131657866-131657888 CAGAAGTAAAATTTTAGGCCAGG + Intronic
1016748214 6:147604171-147604193 AAAAAGTAATCTTGTCAGTCTGG - Intronic
1016912086 6:149209095-149209117 AAGAAGTAATAGAGGCGGCCGGG - Intergenic
1017095912 6:150805228-150805250 TAAAAGTTATAATGTCGGCCGGG - Intronic
1017557737 6:155590309-155590331 AAGAAATAGTATTGTCTGCCTGG - Intergenic
1018192615 6:161323858-161323880 AAGAAGTGGTACTGGCGGCCAGG + Intergenic
1018504691 6:164452097-164452119 AGAAAGTAATATTATAGGCCGGG - Intergenic
1020854477 7:13400186-13400208 AAAAATTAATATTTTTGGCCAGG - Intergenic
1021647047 7:22798841-22798863 AAGAAGTTAAATTTACGGCCAGG + Intergenic
1022220704 7:28310996-28311018 AAGAATAAATATTTTAGGCCAGG + Intronic
1023739312 7:43264548-43264570 AATAATTACTATTGTCAGCCAGG + Intronic
1024072375 7:45796957-45796979 AAAAAGTATTAATTTCGGCCAGG - Intergenic
1025687125 7:63727495-63727517 AAGAAGTATTAATTTTGGCCAGG - Intergenic
1025872722 7:65449803-65449825 AAGAGCTAAAATTGTTGGCCTGG - Intergenic
1026138659 7:67685917-67685939 AAGAAATACTATTGTTGGGCCGG - Intergenic
1026613987 7:71885445-71885467 AAGAAATAACATTGGCGGCTGGG - Intronic
1026618440 7:71928734-71928756 AAAAAGAAATATTCTAGGCCTGG + Intronic
1028329584 7:89572659-89572681 AAAAAGTCATATTGTCGGCTGGG - Intergenic
1028574483 7:92331567-92331589 CAGAAGTGATGTTGTTGGCCAGG - Intronic
1030306312 7:108021956-108021978 AAGAAGTAATCCAGTTGGCCGGG - Intergenic
1030838113 7:114313448-114313470 AAACAAAAATATTGTCGGCCGGG + Intronic
1031288973 7:119908319-119908341 AAAAAGTAATTTTGTGGGCCAGG - Intergenic
1031531138 7:122878355-122878377 AAAACGCAATGTTGTCGGCCGGG + Intronic
1032624787 7:133579988-133580010 AGAAAGTAATATTGTGGGCCGGG - Intronic
1034509972 7:151526073-151526095 AAGAAACAAGATTGTCGACCAGG - Intergenic
1034510023 7:151526433-151526455 AAGAAACAAGATTGTCGACCAGG - Intergenic
1036998902 8:13694183-13694205 AAGCAGTAACTTTGTAGGCCAGG - Intergenic
1037032388 8:14125184-14125206 AAGAATCACTATTGTTGGCCAGG + Intronic
1039049984 8:33484372-33484394 TAGAAGAAAGACTGTCGGCCGGG - Intronic
1039695628 8:39907796-39907818 AAGAAATAATATTTAAGGCCGGG + Intronic
1040055019 8:43050079-43050101 AAAAAATAATAATGTTGGCCAGG - Intronic
1041398271 8:57414909-57414931 AAGATTTAATTTTGTCTGCCTGG + Intergenic
1043402844 8:79900870-79900892 AAGAAGTAAGATTGCCGTCTGGG + Intergenic
1044126423 8:88463703-88463725 AAGACTCAATATTGTTGGCCGGG - Intergenic
1046142301 8:110109769-110109791 AAGAAGTAATATTGTGTTCAAGG + Intergenic
1047815643 8:128459742-128459764 AAGAAGTGATAATCTGGGCCAGG + Intergenic
1049825552 8:144665511-144665533 AAAAAGTAGTTTTGTGGGCCAGG + Intergenic
1050252274 9:3757495-3757517 AAGAAGGAGTATTCTAGGCCAGG + Intergenic
1050655013 9:7818443-7818465 AAGAAATAAAATTGTCGGCCGGG - Intronic
1051759463 9:20445257-20445279 AAGAAGAAGTATTGTGGGCAGGG - Intronic
1052136069 9:24911815-24911837 AAGAAGTCATATTTTCCACCAGG + Intergenic
1052509620 9:29398845-29398867 AAGAAGTGATATGTTGGGCCGGG - Intergenic
1053259522 9:36649789-36649811 AAGAAGAAATATTCCAGGCCGGG + Intronic
1053491328 9:38506470-38506492 AAGAAGAAAACTTGTAGGCCAGG + Intergenic
1053580678 9:39400969-39400991 AAGAATCAATATTGTTGGCCAGG + Intergenic
1053845174 9:42229017-42229039 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054102265 9:60959774-60959796 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054584094 9:66947088-66947110 AAGAATCAATATTGTTGGCCAGG - Intergenic
1054842931 9:69762027-69762049 AAGAATTAGTAAAGTCGGCCGGG + Intergenic
1055050121 9:71971047-71971069 AAGACTTAATATTGTAGGCCGGG - Intronic
1056155540 9:83831983-83832005 AAGAAGTTATGTGATCGGCCAGG - Intergenic
1056606975 9:88093840-88093862 AAGAATTCACATTCTCGGCCGGG - Intergenic
1056991263 9:91413544-91413566 AGGAAATAGTATTGTTGGCCGGG - Intronic
1057018370 9:91675847-91675869 AAAAAGTAAAATTCTCAGCCAGG - Intronic
1057998722 9:99844058-99844080 TAGAAGTGATAATTTCGGCCTGG - Intronic
1058008074 9:99940774-99940796 AAAAAGTAAAATTCTAGGCCGGG - Intronic
1058727402 9:107817387-107817409 AAGAATTAAAATTCTCGGCCAGG + Intergenic
1187059830 X:15775726-15775748 AAGAATTAATATTGGGGGACTGG - Intronic
1187351862 X:18526040-18526062 AAGACTCAATATTGTTGGCCGGG - Intronic
1187423266 X:19154994-19155016 AAGAAGAGATATTGAAGGCCAGG + Intergenic
1188899714 X:35715001-35715023 AAAAAATAAAATTGTCAGCCAGG + Intergenic
1189656102 X:43246689-43246711 ATCAAGTAATTATGTCGGCCTGG + Intergenic
1190187924 X:48252168-48252190 AAAAAGTAATTATGTTGGCCAGG + Intronic
1190568887 X:51762144-51762166 AAGAAATAATATTGACAGGCCGG + Intergenic
1193100317 X:77603669-77603691 AAGAATTAATATTATTGGCCAGG - Intronic
1193438954 X:81515424-81515446 AAAAAGTAGTTTTGTGGGCCAGG + Intergenic
1197431916 X:126376992-126377014 AAAAAGTAGTTTTGTGGGCCAGG - Intergenic
1198888219 X:141362395-141362417 AAGAAGTCATTTTGTGGGCCTGG - Intergenic
1198909600 X:141598075-141598097 AAAAAGTAATTTAGTCGACCAGG - Intronic
1199316702 X:146386741-146386763 AAGAAGTCATTTAGTTGGCCAGG - Intergenic
1199903088 X:152196839-152196861 AAGAAGTAGCATTGTAGGTCAGG - Intronic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic
1202281440 Y:23194909-23194931 AAGAAGTAATTTTCTTGGCCGGG + Intronic
1202284451 Y:23223610-23223632 AAGAAGTAATTTTCTTGGCCGGG - Intronic
1202433112 Y:24809294-24809316 AAGAAGTAATTTTCTTGGCCGGG + Intronic
1202436125 Y:24837996-24838018 AAGAAGTAATTTTCTTGGCCGGG - Intronic