ID: 968155047

View in Genome Browser
Species Human (GRCh38)
Location 3:196373924-196373946
Sequence AAATATCCTCATATTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968155046_968155047 -8 Left 968155046 3:196373909-196373931 CCAAGGTCTAAAAAGAAATATCC 0: 1
1: 0
2: 0
3: 37
4: 545
Right 968155047 3:196373924-196373946 AAATATCCTCATATTGAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 170
968155044_968155047 6 Left 968155044 3:196373895-196373917 CCATGGGTGAAAACCCAAGGTCT 0: 1
1: 0
2: 4
3: 18
4: 169
Right 968155047 3:196373924-196373946 AAATATCCTCATATTGAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 170
968155045_968155047 -7 Left 968155045 3:196373908-196373930 CCCAAGGTCTAAAAAGAAATATC 0: 1
1: 2
2: 55
3: 4963
4: 29367
Right 968155047 3:196373924-196373946 AAATATCCTCATATTGAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968155047 Original CRISPR AAATATCCTCATATTGAGCC AGG Intronic
901310352 1:8264659-8264681 AAATATCCCCACATTGGGCCAGG - Intergenic
902162141 1:14539356-14539378 AAATGTCCTTATATTGCTCCAGG - Intergenic
902714778 1:18265160-18265182 AAATATCCTCCCATCGACCCAGG - Intronic
903523594 1:23974525-23974547 AAATATGATCATTTTGGGCCAGG + Intronic
906180463 1:43813794-43813816 TTTTATCCTCAGATTGAGCCAGG + Intronic
907574930 1:55517848-55517870 AAGCATCATCATCTTGAGCCTGG - Intergenic
911325015 1:96460856-96460878 ACAGAGCCTCATATTGACCCTGG + Intergenic
911746696 1:101448807-101448829 AAATCTCATCATATTGAGGGAGG - Intergenic
911786429 1:101955014-101955036 AAATAGCCTCATAATGAACCAGG - Intronic
915051750 1:153082777-153082799 AAATAACCTCATATTGCACTTGG + Intergenic
916190472 1:162172913-162172935 AAAAAACCTCCTATTGAGCAAGG - Intronic
921209605 1:212882575-212882597 AAATATCCTCATATATCACCCGG - Intronic
921281926 1:213575853-213575875 CAGCATCCTCATATTGAGCTGGG - Intergenic
921553086 1:216562693-216562715 AAATATCATCATTTTCACCCAGG - Intronic
924758080 1:246959719-246959741 AAATATGCCCATTTTGGGCCAGG - Intronic
1062935858 10:1388225-1388247 AAATTTCCTCAAATTGATACAGG + Intronic
1063012810 10:2041943-2041965 AAATATGCTCATCTTGGGGCAGG - Intergenic
1065086030 10:22177801-22177823 AAATGTCCTCAAAATGACCCAGG + Intergenic
1066163677 10:32762024-32762046 AAATATCCACATATTGGGTAGGG + Intronic
1066808916 10:39298694-39298716 AAATATCCTCATATCAAAACTGG - Intergenic
1066811568 10:39344510-39344532 AAATATCTTCATATAAAACCTGG - Intergenic
1067400355 10:45967886-45967908 GAAAATCCTCAAATTGGGCCGGG + Intergenic
1067545758 10:47191526-47191548 AAATATCTCCATTTTGAACCTGG - Intergenic
1067868679 10:49937179-49937201 GAAAATCCTCAAATTGGGCCGGG + Intronic
1068763861 10:60741534-60741556 AAAGATACTCATATGGAGCTGGG + Intergenic
1069844784 10:71363296-71363318 AAAGACCCTCATCTTGACCCAGG - Exonic
1070174081 10:73955717-73955739 AAATAGTCTCATTTTGATCCGGG + Intergenic
1071136669 10:82461833-82461855 AAATATTTTCATATTAGGCCGGG + Intronic
1073341822 10:102750794-102750816 AAATATGCTAAAATTGGGCCGGG - Intronic
1074880026 10:117648760-117648782 AAACATCCTTATATGTAGCCAGG - Intergenic
1076462807 10:130657897-130657919 GCATCTCCTCATATTGAGTCTGG - Intergenic
1079940543 11:26674696-26674718 AAAAATCCACATTTTGGGCCAGG - Intronic
1084470197 11:69354965-69354987 AAATATCCTAACATTGATTCTGG + Intronic
1084997857 11:72999717-72999739 AAATATTCTGATATTGAGTAAGG + Intronic
1085441651 11:76569539-76569561 AAATATACGCACATTGGGCCAGG + Intergenic
1086013062 11:82129024-82129046 AAATATGCTCAGATTTAGGCTGG + Intergenic
1090105337 11:123848707-123848729 CAACTTCCTAATATTGAGCCAGG - Intergenic
1091954240 12:4624589-4624611 AAATATTCTCATACTGATTCAGG - Intronic
1097832789 12:64243154-64243176 AATTATCCTAGAATTGAGCCTGG + Intergenic
1100644545 12:96515303-96515325 AACTATACTCATTTTGGGCCAGG - Intronic
1101185130 12:102268542-102268564 AAACATAGGCATATTGAGCCGGG + Intergenic
1107743868 13:43484795-43484817 AAATATCATCTTATTCAGTCAGG + Intronic
1108915784 13:55609506-55609528 AAAAATCCATATATTGGGCCGGG + Intergenic
1110109219 13:71722533-71722555 AACTATCATCATAGTGAGCTTGG + Intronic
1110541080 13:76707650-76707672 AGATATGCCCATTTTGAGCCTGG - Intergenic
1115304595 14:31920975-31920997 ACATATCTTCATATTAAGACAGG + Intergenic
1115920702 14:38369937-38369959 AAACATCATCATAGGGAGCCAGG - Intergenic
1116093583 14:40339084-40339106 CAGTATCCTCAAACTGAGCCTGG - Intergenic
1116615777 14:47136490-47136512 AAATCTCTTCATATTGAGGCTGG - Intronic
1116623863 14:47241346-47241368 AAACATCCTCATATTGCCTCAGG + Intronic
1118167841 14:63355686-63355708 AAATATACTCAGAATGGGCCTGG + Intergenic
1121829563 14:97038263-97038285 CAATATCTTCACATTGAGCCAGG - Intergenic
1122727756 14:103770186-103770208 AAATTTATTCATATTGGGCCGGG - Intronic
1126357112 15:47808273-47808295 AAATATTCAAATATAGAGCCGGG - Intergenic
1130526440 15:84711080-84711102 AAAAATGCTCATATTAAGGCTGG + Intronic
1130664103 15:85854745-85854767 AAATATTATCATACTGAGCACGG + Intergenic
1133423562 16:5667811-5667833 AAATATCCTCTTGGTGAACCTGG - Intergenic
1134305184 16:13025575-13025597 GAGGATCCTAATATTGAGCCAGG + Intronic
1134333138 16:13268721-13268743 AAATGTCTTCATATTAATCCTGG + Intergenic
1135825530 16:25724166-25724188 AAATATAAACATTTTGAGCCAGG + Intronic
1138380214 16:56595554-56595576 AAAAATGATCATAATGAGCCAGG + Intergenic
1140069854 16:71639970-71639992 AAATATACTGATGTTGAGGCTGG + Intronic
1142625309 17:1187918-1187940 AAATATTATCAAATTGGGCCGGG + Intronic
1143106697 17:4533841-4533863 AGACATCCTCATGGTGAGCCAGG + Exonic
1148000584 17:44385044-44385066 AAATATCCGCAACTGGAGCCTGG + Exonic
1149083190 17:52683026-52683048 AAACATCCTTATAATGAGACAGG + Intergenic
1155413322 18:25569855-25569877 AAATATACTTATTTTCAGCCAGG - Intergenic
1157323317 18:46650602-46650624 AAATATCCTCCTAATCAGCTGGG - Intronic
1159567176 18:70064739-70064761 AAATATCCTAAAATTGATCGTGG + Intronic
1163779975 19:19240976-19240998 AAATATTCTCATTTCTAGCCTGG + Intronic
929517203 2:42614677-42614699 AAATATTCTAATATTCAGCTGGG + Intronic
929634888 2:43508872-43508894 AAATATCCTTATATTGAGTGGGG + Intronic
929670234 2:43871666-43871688 AGATGTCCTCAAAATGAGCCTGG + Intronic
930514507 2:52389116-52389138 AAATATCCTATTATTAGGCCAGG - Intergenic
931232957 2:60389776-60389798 GACTAACCTCATATTGATCCTGG + Intergenic
935863466 2:107359603-107359625 GAATATCTTCATAAGGAGCCAGG + Intergenic
937068470 2:119040713-119040735 AAAGATCATTATATTGGGCCAGG + Intergenic
938621447 2:133059002-133059024 AAATATTCTGATATGCAGCCAGG + Intronic
939253351 2:139712033-139712055 AAATATTCTCAAATTGATTCTGG - Intergenic
941414041 2:165196338-165196360 GAATATCCACATTTTGAGGCAGG - Intronic
944272627 2:197800886-197800908 AAATATTTTTATATTGAGACAGG - Intergenic
1169618615 20:7478871-7478893 AAATAGCCTTGTATTGAACCAGG - Intergenic
1170139494 20:13111579-13111601 AAATAATCTCATATTGACTCTGG + Intronic
1171858384 20:30371761-30371783 AAATGTCATCATAGGGAGCCAGG - Intergenic
1176700352 21:10040526-10040548 AAATATACACACATTCAGCCGGG + Intergenic
1178411645 21:32368495-32368517 AAACATCCTCAAAGTGTGCCCGG - Exonic
1182565450 22:31195245-31195267 AAATATCATCATAATTGGCCGGG - Intronic
1182886514 22:33778294-33778316 AAATATCCTTGTAGTGAGACGGG + Intronic
1183864382 22:40692690-40692712 AAATCTAATCATATTGAGGCAGG - Intergenic
1184075478 22:42174594-42174616 AAAAATCCTCATATATAGCTGGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953713739 3:45297482-45297504 GACTGTCCTCATATTGAGACTGG - Intergenic
954058895 3:48052741-48052763 AAATGTCCTCCTAGTGATCCTGG - Intronic
954189194 3:48944355-48944377 AAATAACCTTATATTGAGTGAGG + Intronic
955567922 3:60269665-60269687 AAATATCCTAGCATTGAGCCAGG + Intronic
960380454 3:116954217-116954239 CCATATCCTCATAATGAGCTAGG - Intronic
960479848 3:118174651-118174673 AAATAGCCTCATGTTTAGGCTGG + Intergenic
962839228 3:139218554-139218576 AAATATCTTCAAGTTGAGCAAGG - Intronic
964191264 3:154003810-154003832 AAAGGTCCTCAGATAGAGCCTGG - Intergenic
965243696 3:166236749-166236771 CAATATCCTGAGATTGAACCAGG - Intergenic
965969971 3:174542865-174542887 AATTATTCTCATAATGAGGCAGG - Intronic
966252627 3:177883647-177883669 AATTATTCTCATATGCAGCCAGG + Intergenic
968155047 3:196373924-196373946 AAATATCCTCATATTGAGCCAGG + Intronic
969412223 4:7035993-7036015 AAATATGTACATATTTAGCCGGG + Intergenic
975028465 4:69582292-69582314 AAATAACATCAAATTCAGCCTGG - Intergenic
975557705 4:75681027-75681049 AAATATAGTCAAATTCAGCCAGG + Intronic
977796246 4:101168415-101168437 AAATATTCTCATCTTTAGCCCGG - Intronic
981783825 4:148455531-148455553 AAATATCAGCATATTGGGCCGGG - Intergenic
989836296 5:45997476-45997498 AAATATCTTCAGATTGAAGCTGG + Intergenic
989855552 5:46284002-46284024 AAATATCTTCAGATTAAACCCGG - Intergenic
989938160 5:50057056-50057078 AAATATCCTCATATAAAAACTGG + Intergenic
991730260 5:69580097-69580119 AAAAATACTTATATTAAGCCGGG + Intronic
991806695 5:70435255-70435277 AAAAATACTTATATTAAGCCGGG + Intergenic
991864691 5:71047751-71047773 AAAAATACTTATATTAAGCCGGG - Intronic
992192599 5:74308598-74308620 AATTATCCTCATACAGATCCAGG + Intergenic
992328296 5:75685809-75685831 AAATATGATCACAGTGAGCCTGG + Intronic
995341119 5:111060909-111060931 AAATAGCTTCATATTGACCCAGG + Intergenic
999905248 5:156134218-156134240 CATTTTCCTCATATTTAGCCTGG + Intronic
1000727054 5:164784702-164784724 AAATATAATCATATTGTTCCTGG + Intergenic
1001133644 5:169084602-169084624 AAATATCCCAATTTTGAGGCTGG - Intronic
1003191282 6:3877594-3877616 ATATATCCTGACATTGTGCCTGG + Intergenic
1003252087 6:4438091-4438113 AAATATACTCATATGTATCCTGG + Intergenic
1003722574 6:8720474-8720496 AAAGATCCTCACATTGTGCCTGG + Intergenic
1005819947 6:29589583-29589605 AAATATCTTCATGTTTAGGCTGG + Intronic
1006242936 6:32702125-32702147 ACATGTCCTTATATTCAGCCAGG + Intergenic
1006326861 6:33360793-33360815 TAATATCCTCAGATTGATCTGGG + Intergenic
1007628826 6:43261446-43261468 AAATATCCTCCTCTTGGGGCTGG + Intronic
1010271928 6:73925265-73925287 AAAGAACCTCACATTGGGCCAGG - Intergenic
1010811612 6:80307004-80307026 TATGTTCCTCATATTGAGCCGGG + Intronic
1011665855 6:89632617-89632639 AAATAACATCAAATTCAGCCTGG - Exonic
1011887608 6:92116627-92116649 ACATATCATCACATTGAGCCAGG - Intergenic
1012131853 6:95504407-95504429 AAATATCATCATTTTGTTCCAGG - Intergenic
1013802517 6:113964116-113964138 AAATAGCCTCACATTGATTCAGG + Intronic
1013810700 6:114041450-114041472 AATTTTGCCCATATTGAGCCTGG + Intergenic
1015891914 6:137977972-137977994 AAATATCCTCATCTTGGACTGGG + Intergenic
1020592115 7:10153023-10153045 CGATCTCCTAATATTGAGCCAGG + Intergenic
1021858957 7:24886545-24886567 AAATATCCTTCTATTGGGGCAGG - Intronic
1022212191 7:28222367-28222389 ACATTTCCACATATTGAGCTGGG - Intergenic
1022271954 7:28817125-28817147 CAATATCCTGATATTGAGGGGGG + Intronic
1025310965 7:57941352-57941374 AAATATCTTCATATTAAAACTGG - Intergenic
1026334455 7:69381721-69381743 TAATATCCACATATTGAGGGAGG + Intergenic
1026971104 7:74468199-74468221 AAATATCTAAATATTAAGCCAGG + Intronic
1027340041 7:77197375-77197397 AAATATCCTCACATGCAGACTGG - Intronic
1030434901 7:109505053-109505075 AAATATCATCAGAGTAAGCCTGG - Intergenic
1030977801 7:116148395-116148417 AACCGTCCTCATCTTGAGCCTGG - Intronic
1031141063 7:117944177-117944199 ATATCTTCTCAGATTGAGCCAGG + Intergenic
1031724153 7:125216040-125216062 AAATACTCTAATATTGAGCATGG - Intergenic
1034170207 7:149057010-149057032 AAATATCTTCATGTTAGGCCAGG + Intergenic
1034368206 7:150570204-150570226 AAATATCCTCTGATTGACCCAGG + Intronic
1034513589 7:151555581-151555603 AAATATATTCATACTCAGCCAGG + Intergenic
1035652042 8:1273883-1273905 TAATATCTTCATATATAGCCGGG + Intergenic
1036727286 8:11231328-11231350 AAATGTCCTCATATCCCGCCAGG - Intergenic
1039632875 8:39132186-39132208 AAATAACCTCCGATTGGGCCAGG - Intronic
1042634778 8:70861717-70861739 AAAAATACTTAGATTGAGCCTGG + Intergenic
1045214688 8:100135899-100135921 AAATAGTCTCATATTTGGCCAGG - Intronic
1045624665 8:104029450-104029472 ATATGTCACCATATTGAGCCAGG - Intronic
1046572070 8:115978859-115978881 AAATATCATAATCTTGAGTCAGG + Intergenic
1046730656 8:117722401-117722423 AAATATCCTCCTGTTGAGGGAGG + Intergenic
1046892360 8:119436725-119436747 AAATATCCTCAAGTAGAGCTAGG - Intergenic
1047462806 8:125084767-125084789 AAACATCTTCATATCCAGCCTGG - Intronic
1051522946 9:18011341-18011363 AAATAAACTCTTATTGAGCCAGG + Intergenic
1053768527 9:41437891-41437913 AAATATACACACATTCAGCCGGG - Intergenic
1055672004 9:78617050-78617072 AAATATGCTTATTTTAAGCCAGG - Intergenic
1057113383 9:92496971-92496993 ACATATTCTAATAGTGAGCCTGG + Intronic
1059670885 9:116491135-116491157 AAATATCCTTATAATGATCTTGG - Intronic
1060696626 9:125714541-125714563 AAAATTCTTCACATTGAGCCTGG - Intergenic
1185832259 X:3313553-3313575 AAAAATACAAATATTGAGCCAGG - Intronic
1186314500 X:8354489-8354511 AAATATCCTGAAAGTCAGCCAGG - Intergenic
1187348067 X:18485296-18485318 AAATTTCATCATTTTGTGCCTGG + Intronic
1187514132 X:19951043-19951065 AAAGTTCCTAATATTGAACCAGG + Intronic
1187711945 X:22063054-22063076 AAAAATCCTCACATCTAGCCAGG - Intronic
1187888856 X:23914588-23914610 TAATATTCTCATAATGGGCCAGG + Intronic
1189656866 X:43253683-43253705 ATATATCCTCTTACTGAGACAGG - Intergenic
1192575762 X:72241998-72242020 AAAAATCTTCATCTTGAGTCTGG + Intronic
1193289844 X:79759754-79759776 CAATCTCCTTATATTGAACCAGG - Intergenic
1196543829 X:116939565-116939587 AAATCTCCTCAAATTGCTCCTGG + Intergenic
1196831627 X:119780348-119780370 AAAAATCCTTTTAATGAGCCAGG - Intergenic
1197582535 X:128301782-128301804 AAATATCTTAAGATTGAACCAGG + Intergenic
1197955052 X:131937458-131937480 AGTTCTCCTTATATTGAGCCAGG - Intergenic
1199186116 X:144917757-144917779 AAATATCCCCAAATTGCTCCTGG + Intergenic
1199197780 X:145052109-145052131 AAATCTCCCAATATTGATCCAGG + Intergenic
1199321604 X:146446185-146446207 AAATCTCCTCACATTGCTCCTGG + Intergenic
1201542598 Y:15123783-15123805 ACATATCTTCATATAGAGCTGGG + Intergenic
1201935043 Y:19401351-19401373 AATAATACTCATTTTGAGCCAGG - Intergenic