ID: 968160501

View in Genome Browser
Species Human (GRCh38)
Location 3:196423076-196423098
Sequence CAGGCGAGGACTTGGCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968160501_968160510 12 Left 968160501 3:196423076-196423098 CCAGCCCGCCAAGTCCTCGCCTG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 968160510 3:196423111-196423133 CCTGATCAAGCCATAACCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968160501 Original CRISPR CAGGCGAGGACTTGGCGGGC TGG (reversed) Intronic
900605177 1:3520634-3520656 CACACCAGGACTGGGCGGGCAGG + Intronic
900951029 1:5858424-5858446 CAGGGGAGGAGCTGGTGGGCTGG - Intergenic
901492005 1:9601469-9601491 AGGGCCAGGAGTTGGCGGGCAGG + Intronic
901633037 1:10657072-10657094 CTGGCCAGAACTGGGCGGGCTGG - Intronic
902446843 1:16472170-16472192 CAGGCGAGGAGTTGGTGGATTGG + Intergenic
902627530 1:17685153-17685175 CACGCGAGGTCTTCGGGGGCTGG + Intronic
902795642 1:18799117-18799139 AAGGCCAGGACATGGCGGGCAGG - Intergenic
903139849 1:21332799-21332821 CAGGCGAGGAGTTAGAGGGAAGG + Intronic
903420777 1:23216988-23217010 CAGGCGAGAACTGGAGGGGCAGG - Intergenic
905800383 1:40838934-40838956 GGGGCGGGGACTTGGCGGGAGGG - Exonic
907069298 1:51519313-51519335 CAGGCGAGGCCGGGGCGGGCGGG + Exonic
910221470 1:84893135-84893157 CAGCGGAGGACGCGGCGGGCGGG + Intronic
912432237 1:109634870-109634892 GAGGAGAGGAGGTGGCGGGCTGG - Intergenic
913592184 1:120340898-120340920 CAGGGGAGGCCTGGCCGGGCGGG + Intergenic
913651174 1:120914248-120914270 CAGGGGAGGCCTGGCCGGGCGGG - Intergenic
914169938 1:145214819-145214841 CAGGGGAGGCCTGGCCGGGCGGG + Intergenic
914525055 1:148458782-148458804 CAGGGGAGGCCTGGCCGGGCGGG + Intergenic
914598621 1:149177048-149177070 CAGGGGAGGCCTGGCCGGGCGGG - Intergenic
914641348 1:149608352-149608374 CAGGGGAGGCCTGGCCGGGCGGG - Intergenic
915333288 1:155126664-155126686 CTGGAGAGGGCTTGGCGGGCGGG - Intergenic
916723610 1:167503774-167503796 CAGGTGAGGACTTGGCCTGGAGG + Intronic
917837622 1:178953594-178953616 AAGGCGAAGTCTTGGGGGGCAGG - Intergenic
922558782 1:226552006-226552028 CAGGAGAGGACTTGCAGGGAAGG - Intronic
922821540 1:228488373-228488395 CAGGCGAGGGCTGGGTGGCCCGG - Intronic
1063419512 10:5900434-5900456 CCGGCGAGGGCCTGGCGGGAGGG - Intronic
1065386085 10:25134413-25134435 CAGGAGAGGACTGGGCGTGGTGG - Intergenic
1067285093 10:44902159-44902181 CGGGCCAGGCCTTGGCAGGCTGG - Intergenic
1069681857 10:70291283-70291305 CATGGGAGGACATGGCGGGAAGG - Intergenic
1070786239 10:79163761-79163783 GAGCAGCGGACTTGGCGGGCTGG - Intronic
1071288903 10:84173996-84174018 GAGGGCAGGCCTTGGCGGGCAGG + Intronic
1071875449 10:89838209-89838231 CAGGCGAGTACGGGGCTGGCGGG + Intergenic
1073061391 10:100735763-100735785 CAGGCGAGGACTAGGGGAGAGGG + Intronic
1075047722 10:119159381-119159403 CAGAGGAGGACTTGGTGGCCAGG + Intronic
1077281308 11:1747454-1747476 CTGGCTAGGTCTGGGCGGGCAGG - Intronic
1077359523 11:2134464-2134486 CAGGAGAGGCCAGGGCGGGCAGG + Intronic
1078596815 11:12694336-12694358 CAGGCCAGAGCTTGGCAGGCTGG - Intronic
1082714690 11:56597796-56597818 CAGGCGAGGACTAAGAGGGGTGG + Intergenic
1082716486 11:56620116-56620138 CAGGCGAGGACTAAGAGGGGTGG + Intergenic
1084725554 11:70939564-70939586 CAGGAGAGGCCTTGGTGAGCAGG - Intronic
1085346028 11:75768712-75768734 CAGGCGCCGACGCGGCGGGCGGG - Exonic
1085391018 11:76182235-76182257 CAGGTGAGGCCTGGGCGGCCAGG + Intergenic
1088796976 11:113273080-113273102 CAGGCGTGGCCGTGGCCGGCGGG - Intronic
1091207663 11:133832767-133832789 CAGGGCAGGACTTCGCGGGGCGG - Intergenic
1092272908 12:7037487-7037509 TGGGCGTGGGCTTGGCGGGCCGG + Intronic
1093077122 12:14770017-14770039 CGGGCGTGGAGTTGGCAGGCAGG - Intronic
1096459544 12:51814597-51814619 CGGCCGAGGACCCGGCGGGCAGG - Intergenic
1097107109 12:56632421-56632443 CAGTCGGGGACTGGGCAGGCAGG + Intronic
1100854451 12:98746346-98746368 TGGGCGTGGGCTTGGCGGGCAGG - Intronic
1102177729 12:110888216-110888238 CAGGGAAGGTCTTTGCGGGCAGG + Intronic
1103244730 12:119446909-119446931 CAGGCAAGGACCTGGAAGGCTGG + Intronic
1103402733 12:120654371-120654393 CAGGAGAGGACACGGTGGGCAGG + Intronic
1104623820 12:130337595-130337617 CAGGCGGGGTCTTGGCGGGATGG + Intergenic
1108200462 13:48038095-48038117 CAGGCGAGGTCTTTGCTAGCTGG + Intronic
1111434106 13:88184011-88184033 GAGGAGAGGACTTGGCTGGCGGG + Intergenic
1113809527 13:113129818-113129840 CCGGCGAGGACTCAGCGGGGAGG + Intronic
1113917822 13:113884570-113884592 CAGCAGAGGCCTTCGCGGGCAGG - Intergenic
1114636150 14:24188124-24188146 CAGGCTGGGACTTGTGGGGCAGG - Intronic
1119330050 14:73786995-73787017 CGGGCGCGGATGTGGCGGGCCGG - Intronic
1122982124 14:105196651-105196673 CAGGCTAGGAGCGGGCGGGCAGG - Intergenic
1123464610 15:20506097-20506119 CAGGCCAGGACCTGACGCGCAGG + Intergenic
1123653504 15:22494944-22494966 CAGGCCAGGACCTGACGCGCAGG - Intergenic
1123743925 15:23303807-23303829 CAGGCCAGGACCTGACGCGCAGG - Intergenic
1124275339 15:28322064-28322086 CAGGCCAGGACCTGACGCGCAGG + Exonic
1124307365 15:28589537-28589559 CAGGCCAGGACCTGACGCGCAGG - Intergenic
1124667332 15:31604763-31604785 CAGGGGAGGACTTCCAGGGCAGG + Intronic
1132175234 15:99708858-99708880 AAGGCTAGGAGTTTGCGGGCGGG + Intronic
1132178959 15:99737101-99737123 CATATGAGGACTTGGCCGGCTGG + Intergenic
1132582454 16:691232-691254 CAGGAAAGGGCTTGGTGGGCTGG - Intronic
1136664881 16:31801818-31801840 CAGGGGAGGACCTGGACGGCAGG + Intergenic
1136927577 16:34388871-34388893 CAGAAGAGGACTTGACAGGCTGG + Intergenic
1136976997 16:35022935-35022957 CAGAAGAGGACTTGACAGGCTGG - Exonic
1138228923 16:55323977-55323999 CAGGCCAGGGCTTGGAGAGCCGG + Exonic
1138436620 16:57004212-57004234 CAGGAGAGGCCTAGGAGGGCCGG + Intronic
1139592644 16:67942061-67942083 CAGGCAAGGGCTGGGCAGGCAGG + Intronic
1139905750 16:70364643-70364665 CAGGTGAGGGCTTGCGGGGCTGG + Exonic
1140479819 16:75256533-75256555 CAGGCCAGGACTTGGAGTGCAGG - Intronic
1142490314 17:274327-274349 CAGGCGAGGCCCAGGTGGGCAGG - Intronic
1143860823 17:9889561-9889583 CATGCGAGGTCTTGGGGAGCTGG + Exonic
1146508258 17:33424053-33424075 CAGGAGATGCCTTGGGGGGCTGG + Intronic
1147454888 17:40530963-40530985 CAGGTGAGGCTTTGGGGGGCAGG + Intergenic
1147503825 17:40993867-40993889 CAGGCCTGGAGTTGGCTGGCAGG + Exonic
1147504259 17:40999623-40999645 CAGGCCCGGAGTTGGCTGGCAGG + Exonic
1147658112 17:42102377-42102399 CAGGCAGAGACTTGGCCGGCAGG - Intronic
1147953199 17:44118427-44118449 CAGGCCATGGCTTGGCAGGCAGG - Intronic
1147995091 17:44355848-44355870 CAGGCGAGGGCTTAGCGTTCAGG + Intronic
1148341585 17:46876517-46876539 CAGGTGAGTACTTGCTGGGCCGG - Exonic
1150249633 17:63698764-63698786 CAGGCGAGGCGGGGGCGGGCAGG + Intronic
1151360203 17:73584194-73584216 CAGGCGAGGTCCCGGCGGCCAGG - Intronic
1151827399 17:76530925-76530947 CAGCAGAGGACATGGCGGGGAGG + Intronic
1157578154 18:48757870-48757892 AAGGCGATCACTGGGCGGGCTGG - Intronic
1161118425 19:2512179-2512201 CAGACGGGGAGCTGGCGGGCGGG - Exonic
1161135555 19:2617505-2617527 CAGGCCAGGTCTTTGAGGGCTGG - Intronic
1161795041 19:6381530-6381552 TAGGCGATGGCTGGGCGGGCCGG - Intronic
1162744130 19:12789709-12789731 CAGGCGGGGACCTGCCGGGCTGG + Intronic
1163243140 19:16076463-16076485 CAGGCAAAGGCTTGGGGGGCCGG + Intronic
1163250341 19:16122986-16123008 CAGGGGAGGGCTTGGTGGTCAGG - Intronic
1164146858 19:22517822-22517844 CAGGCGAGGACAGGGTGAGCAGG - Intronic
1166184923 19:41133623-41133645 CAGACAAGGACTTGGGGGACTGG + Intergenic
1166213200 19:41320350-41320372 CAGGCAAGGACTCGGAGGCCTGG + Exonic
1166378789 19:42343865-42343887 CAAGCGGGGACTTGGGAGGCCGG + Intronic
1167072068 19:47227360-47227382 CAGGCCAGGACCTGGTGGGACGG - Intronic
1168063422 19:53906770-53906792 CTGGCCAGGACTAGGCGGTCTGG - Exonic
1168301138 19:55405868-55405890 CAGGGGAGGACCTAGCAGGCCGG - Intronic
1168509979 19:56966486-56966508 GAGGCGTGGACTTGCGGGGCAGG + Intergenic
925060319 2:885628-885650 CAGGGGAAGACTAGGCGGACTGG + Intergenic
925352045 2:3208307-3208329 CAGGAGAGGTCTGGGCAGGCAGG + Intronic
926113653 2:10197594-10197616 CAGGCTAGGAGTAGGGGGGCTGG + Intronic
932414221 2:71564130-71564152 GAGAAGAGGACTTGGTGGGCGGG - Exonic
932771627 2:74503674-74503696 CGGGCGAGTACCTGGCGGCCGGG - Intergenic
935692643 2:105744947-105744969 GAGGGGAGGGCTTGGCGGCCGGG + Exonic
936104491 2:109613656-109613678 CCGGGGAGCACTGGGCGGGCGGG + Intronic
938112003 2:128574197-128574219 CAGGAGAGGACTTTGCTTGCTGG + Intergenic
944203922 2:197137134-197137156 CAGACATGGACTTGGTGGGCTGG - Intronic
946413823 2:219529378-219529400 AAGGAGAGGACTTGGGGGACAGG + Intronic
948591418 2:239053233-239053255 CAGGCCAGGGCTAGGCTGGCGGG - Intronic
1172635720 20:36408372-36408394 CACCCGAGGACTAAGCGGGCGGG + Intronic
1173231883 20:41204814-41204836 CAGGCAAGGTCTCAGCGGGCTGG + Exonic
1174611357 20:51801152-51801174 CAGGCGACAATTTGGCGGGCCGG + Intronic
1179433626 21:41344403-41344425 CAGGCGAAGACTTCGCGGAGCGG + Intronic
1179833313 21:44012092-44012114 GAGGCCAGGACTCGGCAGGCGGG - Intergenic
1180109900 21:45642972-45642994 TGGGCGGGGATTTGGCGGGCGGG - Intergenic
1180160067 21:45995168-45995190 CAGGGCAGGGCTTGGCAGGCGGG + Intronic
1182150833 22:28026099-28026121 CACGCGTGGATTTGGAGGGCAGG + Intronic
1183803216 22:40185758-40185780 CAGAGGAGGACTTGGTGGGGGGG + Intronic
1183864133 22:40690720-40690742 CAGGCCAGGCCTGGGAGGGCAGG - Intergenic
1185347468 22:50316899-50316921 CAGGCAAGGACAGGGCGGGGGGG + Intronic
1185389335 22:50550270-50550292 CAGACAAGGACTTGGCTCGCTGG + Exonic
950106704 3:10393177-10393199 AAGCCAAGGACATGGCGGGCCGG + Intronic
953027757 3:39154421-39154443 CAGGCCAGGACTTGGTTGCCGGG - Intronic
954445292 3:50543046-50543068 AAGGCGAGGACAGGGCAGGCAGG - Intergenic
954553288 3:51499730-51499752 CCGGCGAGGAGGGGGCGGGCCGG - Intronic
954779138 3:53046229-53046251 GAGGCAAGGACTCCGCGGGCTGG + Intronic
958022613 3:88015752-88015774 TCGGCGTGGGCTTGGCGGGCCGG + Intergenic
958419854 3:93917650-93917672 TGGGCGTGGGCTTGGCGGGCCGG + Intronic
961442384 3:126960695-126960717 CAGACGAGGGCAGGGCGGGCCGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
966883239 3:184361539-184361561 CCGGCGCGGACTTTGCGGGCCGG - Exonic
968160501 3:196423076-196423098 CAGGCGAGGACTTGGCGGGCTGG - Intronic
968514208 4:1009637-1009659 CGGGCTGGGACGTGGCGGGCGGG + Intergenic
968601897 4:1513431-1513453 CGGGCAGGGACTTGGAGGGCGGG - Intergenic
968985364 4:3871842-3871864 CTGGCGGGGACGTGGCGGGGCGG + Intergenic
969670425 4:8587169-8587191 CCGGCCAGGACTTGGCGGAACGG - Exonic
976621152 4:87128631-87128653 CAGGCCAGGATCTTGCGGGCTGG - Intronic
983656719 4:170091292-170091314 TGGGCGTGGGCTTGGCGGGCCGG + Intronic
985629130 5:1005645-1005667 CAGGAGAGGACACGCCGGGCTGG + Intergenic
985964120 5:3326649-3326671 CAGGCTAGGTCTAGGCAGGCCGG - Intergenic
987081459 5:14428913-14428935 CAGGAGAGGACGTGGCGGCCTGG - Intronic
992042465 5:72848805-72848827 CGGGCGGGGACGTGGCGGCCCGG - Intronic
994891146 5:105638530-105638552 CAGGGGAGGACTGGACTGGCTGG + Intergenic
997521641 5:134527258-134527280 CAGGCGGGGAGGAGGCGGGCGGG - Intronic
997986424 5:138504910-138504932 CAGGGCTGGACTTGGCAGGCAGG + Intergenic
1000320847 5:160133343-160133365 CAGGCCAGGAGTGGGTGGGCGGG - Intergenic
1002339540 5:178505976-178505998 CAGCCATGGACTTGGGGGGCTGG - Intronic
1019197536 6:170291121-170291143 CAGGGGAGGACTGGGGGGGCGGG - Intergenic
1019258777 7:68241-68263 CAGGCGAGGGCCAGGCGAGCTGG - Intergenic
1019828171 7:3301085-3301107 CAAGCGAGGGCCTGGGGGGCGGG + Intergenic
1022715069 7:32891625-32891647 CAGGCGAGGCCGCGGCGGGAGGG - Exonic
1023287055 7:38631223-38631245 CAGGCGGGGGCTTGGCCGGAGGG - Intronic
1025708312 7:63886773-63886795 CAGGCTAGGTCTTGAGGGGCAGG + Intergenic
1026019690 7:66697545-66697567 CAAGTGAGCACTTGGCAGGCGGG + Intronic
1026880695 7:73905035-73905057 CAAGTGAGCACTTGGCAGGCAGG - Intergenic
1035565980 8:641724-641746 CAGGAGAGGAATCGGCGGGGAGG - Intronic
1037882130 8:22578627-22578649 CAGGAAGGGAGTTGGCGGGCAGG + Intronic
1038612302 8:29068327-29068349 CGGGCCAGCACTTGGCAGGCAGG - Exonic
1039390237 8:37174523-37174545 CCAGGGAGGACTTGGAGGGCTGG - Intergenic
1039595605 8:38787662-38787684 CCGGCGAGGACGAGGCTGGCGGG + Exonic
1040074978 8:43220141-43220163 CAGGGGAGGACCTGGTGGGGAGG + Intergenic
1041719612 8:60964289-60964311 CAAGCGTGGACTTGGCAGGCAGG - Intergenic
1045649655 8:104329985-104330007 CCGGGGAGGGCCTGGCGGGCCGG - Intergenic
1047024674 8:120812275-120812297 GAGGGGAGGTCTGGGCGGGCGGG - Intronic
1052970224 9:34372808-34372830 CAGGTGAGAAGTTGTCGGGCAGG + Exonic
1054815528 9:69471003-69471025 CAGGCTATGAATTGGCAGGCTGG - Intronic
1055454335 9:76459116-76459138 GAGGCGGGGACGTGGTGGGCGGG + Intronic
1056753022 9:89365217-89365239 CAGGCCAGGCCCTGGAGGGCAGG + Intronic
1059456970 9:114405976-114405998 CAGGCCAGGCCATGGCGGACAGG + Intronic
1060228153 9:121808735-121808757 CAAGCGAGGACATGGAGGGGTGG - Intergenic
1061017618 9:127991098-127991120 CAGGCCAGGAGTCGGCAGGCTGG + Intergenic
1061387973 9:130301606-130301628 CAGCCGAGGACGTGGCTGGATGG + Intronic
1061659136 9:132116766-132116788 CAGGTGAGGACACGGAGGGCAGG - Intergenic
1061761979 9:132857560-132857582 CAGGAGAGGACCTGAGGGGCTGG - Intronic
1062430679 9:136525656-136525678 GAGGCGAGGACTTGGGGGGCCGG - Intronic
1062664699 9:137663078-137663100 CAGGCCAGGACTGGGCGCGGTGG - Intronic
1062696118 9:137877382-137877404 CCGGCGGGGACGGGGCGGGCCGG + Intergenic
1186349736 X:8730247-8730269 CAGGGTAGGACTCGGAGGGCTGG + Intronic
1189789123 X:44586619-44586641 CAGCCAAGGAATTGGCTGGCCGG - Intergenic
1200014320 X:153147230-153147252 CAGGAGAGGACCTGGCCGGAGGG + Intergenic
1200025282 X:153252724-153252746 CAGGAGAGGACCTGGCCGGAGGG - Intergenic
1200213947 X:154359226-154359248 CAGGTGAGGAGGTGGCGGCCAGG - Exonic