ID: 968160743

View in Genome Browser
Species Human (GRCh38)
Location 3:196424627-196424649
Sequence CTTTGGAATGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120670
Summary {0: 2, 1: 77, 2: 2660, 3: 30607, 4: 87324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968160743_968160750 6 Left 968160743 3:196424627-196424649 CCTTCCACCTTGGCATTCCAAAG 0: 2
1: 77
2: 2660
3: 30607
4: 87324
Right 968160750 3:196424656-196424678 GATTACCGGTGTGAGCCACTAGG 0: 4
1: 397
2: 1659
3: 3252
4: 4061
968160743_968160748 -8 Left 968160743 3:196424627-196424649 CCTTCCACCTTGGCATTCCAAAG 0: 2
1: 77
2: 2660
3: 30607
4: 87324
Right 968160748 3:196424642-196424664 TTCCAAAGTGCTGGGATTACCGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968160743 Original CRISPR CTTTGGAATGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr