ID: 968161570

View in Genome Browser
Species Human (GRCh38)
Location 3:196431823-196431845
Sequence GGCCACGGCGATGGCTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968161552_968161570 20 Left 968161552 3:196431780-196431802 CCACCGGCCTTGCCGTGAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161558_968161570 13 Left 968161558 3:196431787-196431809 CCTTGCCGTGAAGGCGGGAGGGC 0: 1
1: 0
2: 1
3: 7
4: 121
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161563_968161570 -9 Left 968161563 3:196431809-196431831 CCCGAACCCGCCAGGGCCACGGC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161564_968161570 -10 Left 968161564 3:196431810-196431832 CCGAACCCGCCAGGGCCACGGCG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161555_968161570 17 Left 968161555 3:196431783-196431805 CCGGCCTTGCCGTGAAGGCGGGA 0: 1
1: 0
2: 1
3: 1
4: 86
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161551_968161570 21 Left 968161551 3:196431779-196431801 CCCACCGGCCTTGCCGTGAAGGC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161549_968161570 26 Left 968161549 3:196431774-196431796 CCGAACCCACCGGCCTTGCCGTG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70
968161559_968161570 8 Left 968161559 3:196431792-196431814 CCGTGAAGGCGGGAGGGCCCGAA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968161570 Original CRISPR GGCCACGGCGATGGCTCCGA GGG Intronic
900201220 1:1407528-1407550 GGCCGCAGCTGTGGCTCCGAGGG + Intergenic
902360718 1:15941357-15941379 GGCCACTGCCCTGGCTCTGATGG - Intergenic
905648241 1:39639563-39639585 GCCCACGTCGATGGGTCCGTCGG + Exonic
906636975 1:47416385-47416407 GGCGACGGCGGCGGCCCCGACGG - Exonic
908780545 1:67685961-67685983 GGGGGCGGCGATGGCCCCGAGGG + Intronic
915515428 1:156409790-156409812 AGCCAGGGCCAAGGCTCCGAGGG - Intronic
922753551 1:228082216-228082238 GGCCACGGCGGAAGGTCCGAAGG - Intergenic
1078650049 11:13182051-13182073 GGCCAAGGCGATGGATCACAAGG - Intergenic
1081065781 11:38537333-38537355 GGTCACGGAGATGGCTCCTGAGG + Intergenic
1083842870 11:65314809-65314831 GGCCCCGGCATTGGCTCCGCGGG + Exonic
1092766128 12:11854605-11854627 GGCAAGGGTGATGGCTCAGAAGG - Intronic
1096084734 12:48857863-48857885 GGCCACGGTGAGGGCTTGGAAGG - Exonic
1096482414 12:51951585-51951607 GGCCGCGGCGCCGGCTCCGCCGG + Intergenic
1097184938 12:57191474-57191496 GGCCACGGCGATGATGCCCATGG - Exonic
1100391510 12:94149105-94149127 GCTCGCCGCGATGGCTCCGATGG - Exonic
1104176286 12:126335942-126335964 GGACACAGCGATGGCTCTGGGGG - Intergenic
1119426237 14:74536118-74536140 GCCCAGGGCGATGGCTTCGGGGG - Intronic
1132625063 16:887738-887760 GGCCACGGCCATGCCTTCCAGGG - Intronic
1133304879 16:4802547-4802569 GGCCACCGTGATGGCAGCGACGG - Exonic
1133916126 16:10111615-10111637 GGCCATCGCGATGGCTCTGATGG + Intronic
1141695072 16:85615222-85615244 GCCCAGGGCGCAGGCTCCGACGG + Intronic
1141989746 16:87602975-87602997 GGCCGCGGCGCCGGCTCCGGAGG - Exonic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1203122911 16_KI270728v1_random:1554937-1554959 GCGCACGGCGCTGGCGCCGAGGG - Intergenic
1143091025 17:4449255-4449277 GGCCATGGCGGTCACTCCGAGGG - Exonic
1143490641 17:7283558-7283580 GGCCACGGAGAGGGCCCAGAGGG - Exonic
1145254590 17:21315724-21315746 GGCTCCGGAGAAGGCTCCGAGGG + Intergenic
1145322008 17:21772241-21772263 GGCTCCGGAGAAGGCTCCGAGGG - Intergenic
1150682817 17:67296930-67296952 GGTCACGGCGATGTCTCAGGAGG - Intergenic
1151361530 17:73592205-73592227 GGCCACAGCCATGCCTCCGTGGG + Intronic
1162832967 19:13298640-13298662 GGCGAGGGCGAGGGCCCCGACGG - Exonic
1165020898 19:32923105-32923127 GGCCCCAGCGATGGCTCCCAGGG - Intronic
1166211651 19:41310322-41310344 GGCGACGGCGACGGCGGCGAAGG + Exonic
1166375316 19:42324307-42324329 GGCGGCGGCGGTGGCCCCGAGGG + Intronic
1168719041 19:58544818-58544840 GGCCCGGGCGAGGGCTCCGCTGG + Exonic
930177127 2:48313178-48313200 GGCAACAGTGATTGCTCCGAAGG + Intergenic
938119524 2:128623823-128623845 GGCCATGGTGATGGGTCTGAGGG + Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
944547501 2:200812212-200812234 CGCCGCGGCGCTGGCTGCGAAGG + Intronic
944581906 2:201138802-201138824 GGCCATCGTGATGGCTCTGATGG - Intronic
948672481 2:239577442-239577464 GAGCACTGAGATGGCTCCGAAGG + Intergenic
1170629706 20:18056703-18056725 GGCGACGCCGAGGGCCCCGATGG - Exonic
1171215599 20:23350275-23350297 GGCCACGGCGAGGGCAACGCCGG - Intergenic
1173514064 20:43652561-43652583 GGCCATGGCCATGGCTCACATGG - Intergenic
1175880711 20:62257151-62257173 GGACACGGCGATGGCTCCGTTGG + Intronic
1176271670 20:64238625-64238647 GGGGACGGGGATGGCTCCGCCGG - Intronic
1177513569 21:22120761-22120783 GGCCACGGCAACGGCCACGACGG + Intergenic
1179568483 21:42263865-42263887 GGCCACGGCGTTGCCTGAGACGG + Intronic
1185107894 22:48884824-48884846 GGCCCCGGCGATGGCGCCTGTGG + Intergenic
950779089 3:15375649-15375671 GGCCGCGGCGATGGCGACGGCGG + Intergenic
950831248 3:15878280-15878302 GGCCATCGCGATGGCTCTGATGG + Intergenic
953434059 3:42864801-42864823 GGCCACGGAGATGCCCCAGAAGG - Exonic
954086416 3:48247535-48247557 GGCCACAGCCAAGGCTCAGAGGG + Intronic
954334504 3:49908509-49908531 AGCCACAGCGAGGGCTCTGAAGG + Intronic
954649817 3:52154268-52154290 GGCCAGAGCGATGGCTGCGAGGG - Intronic
955732644 3:62003435-62003457 GGCCACAGCAATGGCTCAGCGGG + Exonic
961534237 3:127559747-127559769 GGCCACTGAGATGGCTCCCAGGG - Intergenic
966592147 3:181695464-181695486 GGGCGCGGCCCTGGCTCCGAAGG - Intergenic
968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG + Intronic
972290482 4:37686275-37686297 CGACGCGGCGATGGCTCCGCGGG - Exonic
976830305 4:89307704-89307726 CGCCACACCGATGGCTCCGGCGG + Exonic
996810063 5:127506744-127506766 GGCCAGGGCGATGGAACAGAGGG + Intergenic
1000875895 5:166637932-166637954 GGCCAAGGCGGTGGATCCCAAGG + Intergenic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1002575231 5:180170554-180170576 GGCCAGGGCGGGGGCTCCGCGGG - Intronic
1004732160 6:18368382-18368404 GGCCATTGCGATGGCTCTGATGG - Intergenic
1007721905 6:43890241-43890263 GGCCATGGCCATGGCTGGGACGG + Intergenic
1019343085 7:517623-517645 GGCCGGGGCGAGGGCTCCGCGGG - Intronic
1019349886 7:549744-549766 GGCCGCGGCCCTGGCTCCCAAGG + Exonic
1029567320 7:101347688-101347710 GGCCCCGGCGATCGCTGAGAGGG - Intergenic
1032391162 7:131556277-131556299 GGCGACGGCGACGGCGACGACGG + Exonic
1033096990 7:138440933-138440955 GGCCATCGCAATGGCTCTGATGG + Intergenic
1039618237 8:38974161-38974183 GGCCACGGCGCCGCCTCCGCCGG - Exonic
1052941442 9:34134444-34134466 GGCCATCGCGATGGCTCTGATGG - Intergenic
1052987182 9:34496298-34496320 GGCCAGGCCCATGGCTCCCAAGG - Intronic
1189362074 X:40360471-40360493 GGCCATCGCGATGGCTCTGATGG - Intergenic
1189659270 X:43279403-43279425 GGCCATCGTGATGGCTCTGATGG - Intergenic
1192233741 X:69283446-69283468 GGCCACGCGGATGGCTGCGTAGG + Intergenic
1192341471 X:70267168-70267190 GGCTATGGCTATGGCTCAGAGGG - Intergenic
1195702500 X:107715926-107715948 GGCCACCACGCTGGCTCCGGAGG + Exonic