ID: 968177199

View in Genome Browser
Species Human (GRCh38)
Location 3:196561264-196561286
Sequence TGTGAGGCATAGAGCTTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968177191_968177199 27 Left 968177191 3:196561214-196561236 CCAAGGAATCTTTGAGGGACCTG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 968177199 3:196561264-196561286 TGTGAGGCATAGAGCTTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
968177192_968177199 8 Left 968177192 3:196561233-196561255 CCTGACATCCAGTACACTAATGG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 968177199 3:196561264-196561286 TGTGAGGCATAGAGCTTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
968177194_968177199 0 Left 968177194 3:196561241-196561263 CCAGTACACTAATGGTTTCTCCA 0: 1
1: 0
2: 1
3: 14
4: 137
Right 968177199 3:196561264-196561286 TGTGAGGCATAGAGCTTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968177199 Original CRISPR TGTGAGGCATAGAGCTTGGT GGG Exonic
903114443 1:21167090-21167112 TGTAAGAAATAGAACTTGGTCGG - Intronic
905386917 1:37611494-37611516 TGTGGAGCTTAGAGGTTGGTGGG - Intronic
905546317 1:38802997-38803019 TCTGAGGGATAGAGCTTGCAGGG + Intergenic
906749302 1:48244490-48244512 TTTGAGCCTTAGACCTTGGTGGG - Intronic
907316695 1:53577017-53577039 AGTGAGGCACAGAGATTGGGTGG - Intronic
908502759 1:64760552-64760574 GCTGAGGCATAGAGTTTGATAGG + Intronic
916413196 1:164567927-164567949 TGTGGGGCATTGAGCTGGGCCGG + Intronic
917728237 1:177848062-177848084 GGTGAGGAATAGAGCTTGGAAGG - Intergenic
920500897 1:206484921-206484943 TGGGAGGCAGAGAGCTCTGTTGG - Intronic
923307571 1:232702250-232702272 TGTGAGCCATAGCGCGTGGCCGG - Intergenic
923933213 1:238727056-238727078 CGTGAGGCAGGGAGTTTGGTTGG + Intergenic
1071166509 10:82814146-82814168 TATGAGTCATAGAGCTTGGGAGG - Intronic
1071486257 10:86104498-86104520 TGTGAAGCACTGAGCATGGTGGG - Intronic
1072107086 10:92284421-92284443 TGTGAAACAAAGAGCTTTGTAGG - Intronic
1072207399 10:93216396-93216418 TCTGAGGAAAAGAGGTTGGTGGG - Intergenic
1073044935 10:100631523-100631545 TCTGGGGCACAGAGCCTGGTTGG + Intergenic
1076483782 10:130802586-130802608 TGTGAGGCATAGCTCTTCCTGGG - Intergenic
1078561972 11:12380102-12380124 TGTGAGGAATAGAGGATGTTGGG - Intronic
1081824138 11:46031110-46031132 TCTGAGGCTTTGAGCTTGGGTGG - Intronic
1086775554 11:90828143-90828165 TGTGATGCATAGATTTTTGTTGG - Intergenic
1091011145 11:132001678-132001700 TGTTTGGCATAGGGCCTGGTGGG - Intronic
1092342200 12:7686401-7686423 TGTGATTCATAGAGGTTGATAGG - Intergenic
1092619137 12:10244335-10244357 TGTGAGTCCTTGAGCCTGGTGGG - Intergenic
1093099277 12:15007898-15007920 GGTGAGGTATAGAGCTGGGAAGG + Intergenic
1094304004 12:28997404-28997426 TGTCAGGCCTATAGGTTGGTGGG + Intergenic
1097280860 12:57845097-57845119 ACTGAGGCCTAGAGCCTGGTGGG - Intronic
1099448009 12:82775167-82775189 TGTGAGTCATTGTGCTTGGCCGG - Intronic
1099560597 12:84169462-84169484 TGTGAGGCATAGGATTTGTTGGG - Intergenic
1100304683 12:93339481-93339503 TGTGAGCCATCGTGCCTGGTTGG - Intergenic
1103906840 12:124332163-124332185 TGTGAGGCAAAGGGCCTGGGGGG + Intronic
1104916164 12:132265740-132265762 TGTGTGGCTAAGAGCTTGGTGGG - Intronic
1105585384 13:21738468-21738490 TGTGAGGAGTTGAGCGTGGTGGG + Intergenic
1107501607 13:40983961-40983983 TTTGAGGCATAGATGTTGGGAGG - Intronic
1110331208 13:74275207-74275229 TGTGAGGCGGAGTGATTGGTGGG + Intergenic
1114187391 14:20413293-20413315 TCTGAGGCTGAGAGCTGGGTGGG - Intronic
1115236074 14:31209616-31209638 TGTGAGCCATGGAGCCTGGACGG - Intergenic
1116182070 14:41547404-41547426 GGTGAGGCATGCAGCTTGGCAGG + Intergenic
1116869274 14:50056175-50056197 TTTGGGGCTGAGAGCTTGGTGGG - Intergenic
1117427312 14:55614085-55614107 CGTGAGGTATAGAGAGTGGTAGG + Intronic
1127948068 15:63775450-63775472 TTTGAGGCATAAAACTTGTTGGG + Exonic
1128639495 15:69325711-69325733 TGAGAGGCAGCGAACTTGGTAGG - Intronic
1129598408 15:76982732-76982754 CGGGAGGGAGAGAGCTTGGTCGG + Intergenic
1130251524 15:82303155-82303177 TCTGAGTCCTAGAGCTTGGGTGG + Intergenic
1134071063 16:11260043-11260065 GGTGAGGCATAGGGGTTGGCAGG + Intronic
1135006627 16:18829574-18829596 TGTGAGTCCGAGGGCTTGGTTGG + Exonic
1140638472 16:76944342-76944364 TGTGAGAAATACAGCTTGTTGGG - Intergenic
1141977110 16:87524296-87524318 GGTGAGGCAAAGAGCCTGGCAGG + Intergenic
1142530118 17:573733-573755 TGTGAGGCTTCGCGCTTGCTAGG - Intronic
1144757909 17:17691391-17691413 TTTGAAGCATAGAGCGTGGTAGG + Intronic
1144802202 17:17937387-17937409 TGTGAGGCATTGATCATGGCTGG - Intronic
1147296148 17:39484243-39484265 TGGCAGTCCTAGAGCTTGGTAGG + Intronic
1148681473 17:49476361-49476383 AGGGAGCCATAGAGTTTGGTTGG - Intronic
1149885937 17:60340292-60340314 TGTGAGCCACTGAGCTTGGCAGG - Intronic
1150133107 17:62679929-62679951 TGCGAGGCCGGGAGCTTGGTGGG + Intronic
1151439640 17:74119909-74119931 TATGAGACTCAGAGCTTGGTGGG - Intergenic
1157010060 18:43636775-43636797 TGAGATGCATAGGGCTTGGCTGG - Intergenic
1157300265 18:46474171-46474193 TGTGAAGCACAGTGCCTGGTAGG + Intergenic
1157724965 18:49957358-49957380 TGTGAGCCATTGCGCCTGGTTGG - Intronic
1158533455 18:58284500-58284522 TGTGAGACAAAAAGCTTTGTGGG + Intronic
1159020777 18:63141519-63141541 TGAGAGGCAGAGGGCTTTGTGGG - Intronic
1159654187 18:71012135-71012157 AATGAGGCATAGGGCTTGTTGGG - Intergenic
1160538646 18:79608796-79608818 TGTGATGCTCAGAGCTTGGCCGG - Intergenic
1160785528 19:898753-898775 TGCGGGGCTTGGAGCTTGGTGGG - Intronic
1163206404 19:15806687-15806709 TGTGAGCCACAGTGCTTGGCTGG + Intergenic
1165348790 19:35265670-35265692 TGTCAAGCCTAGAGCCTGGTGGG + Intronic
1165424154 19:35736806-35736828 GTTGAGGCAGAGAGCTTGGAGGG + Exonic
1166566783 19:43770328-43770350 TGGGAGGCATAGACCTTGGAAGG - Intronic
1167049809 19:47071474-47071496 TGTGAGGCTGAGAGGCTGGTGGG - Intronic
925245321 2:2377567-2377589 TTGGAGGCAGAGCGCTTGGTGGG + Intergenic
926924791 2:17976598-17976620 TGTTAGAGATAGGGCTTGGTAGG - Intronic
932442660 2:71747520-71747542 TCAGAGGGATAGAGCTTGGTAGG - Intergenic
935973284 2:108552920-108552942 TCTGAGGCATAGAGATAGATTGG + Intronic
937227355 2:120377456-120377478 TGAGAGGAATCGAGCCTGGTGGG + Intergenic
937842549 2:126538134-126538156 TGTGAGGCTGAGAGAGTGGTGGG - Intergenic
939974253 2:148697938-148697960 TGTCAGGCACAGTGCTTAGTTGG - Intronic
943810101 2:192174786-192174808 TGTGAGCCCAAGCGCTTGGTGGG + Intronic
944106561 2:196085047-196085069 TGTGGGAGATAAAGCTTGGTTGG - Intergenic
946385377 2:219381286-219381308 TGTGATGGAGGGAGCTTGGTGGG - Intronic
1169426043 20:5498012-5498034 TGTGGGGCTCAGAGATTGGTTGG + Intergenic
1171466068 20:25328870-25328892 TGGGAGGCATGGAGCTTGGTTGG + Intronic
1176928456 21:14779290-14779312 TGTGAGGCAGCAAGCTTGGCTGG + Intergenic
1177263708 21:18758154-18758176 GGTGAGTCCTAGAGCTTGGCTGG + Intergenic
1178048190 21:28719622-28719644 AGTGTATCATAGAGCTTGGTTGG - Intergenic
1182163081 22:28143181-28143203 TATGATGCCTAGAGCATGGTAGG + Intronic
1182867200 22:33613984-33614006 TGTGTGGCATACAGCTGGGTGGG - Intronic
1184952923 22:47857992-47858014 TGTGGGGCATAGACCAAGGTAGG - Intergenic
1185282422 22:49979605-49979627 TGTGAGCCACAGCGCCTGGTTGG + Intergenic
952861323 3:37815002-37815024 AGTGGGGCATAGAGCTTGCAAGG + Intronic
954986597 3:54799776-54799798 TGTGAGGCAGACAGCCTGTTTGG - Intronic
955112505 3:55962876-55962898 TGTGCTCCATAGAGCTTTGTAGG - Intronic
958614296 3:96471289-96471311 TGTGAGGCATAGTTTTAGGTTGG - Intergenic
960201767 3:114845492-114845514 GGTGAGGCACAGAGGTGGGTAGG - Intronic
963035275 3:141020295-141020317 TGTGAGGCATGGAGCCCTGTGGG + Intergenic
966125207 3:176568358-176568380 TGTGAGGCATAGAGATGCTTAGG - Intergenic
966925626 3:184642934-184642956 TGTGAAGCATAGGGCCTGGGAGG - Intronic
968177199 3:196561264-196561286 TGTGAGGCATAGAGCTTGGTGGG + Exonic
969051201 4:4374281-4374303 TTTGAGGCATAGAATTTGCTGGG + Intronic
969925146 4:10578394-10578416 TGTGAGGCACAGAGATTCGGTGG + Intronic
970120431 4:12747092-12747114 TGGGAGGCAGAGGGCTTGCTGGG - Intergenic
973663041 4:53127564-53127586 TGTGAGGCATTGAGCTGGTCTGG + Intronic
974003803 4:56535977-56535999 TGTGAGGGATCTAGCTTGCTGGG - Intronic
978362632 4:107947412-107947434 TGTGAGGGAAGGAGCTCGGTTGG - Exonic
980556345 4:134410468-134410490 TGTGAAACATAGAACTTGATAGG - Intergenic
981418606 4:144522638-144522660 TTTGAGTCATAGAGCCTGGCAGG - Intergenic
981652297 4:147073690-147073712 TGTGAGCCATCGAGCCTGGCTGG - Intergenic
982844611 4:160234137-160234159 TGTCAGGCATAGAGTTTAGTGGG + Intergenic
984624714 4:181993668-181993690 TTTGAGGCATAGGACATGGTTGG - Intergenic
985584039 5:718147-718169 TGTGAGACATACAGGTTGGTGGG + Intronic
985597541 5:802449-802471 TGTGAGACATACAGGTTGGTGGG + Intronic
987976653 5:25023480-25023502 TGAGAGGCATAAAGCTTAGCTGG - Intergenic
988174547 5:27704662-27704684 AGTGAGGCAAAGAGGTTGTTTGG - Intergenic
989094955 5:37773219-37773241 TGTGTGGCATAGATTATGGTAGG + Intergenic
999198577 5:149799978-149800000 TGTGAGCCATTGCGCTTGGCTGG + Intronic
1000089084 5:157914493-157914515 TGAGAAGCATAGACCTAGGTGGG + Intergenic
1001613015 5:173018732-173018754 TCTGAGGCCTAGAACTTAGTAGG + Intronic
1003075914 6:2983458-2983480 TGTGAGGCAGAGAGCTAATTAGG + Intergenic
1004392069 6:15218289-15218311 TCTGAGGCATAGACCTTAATTGG + Intergenic
1007930144 6:45683381-45683403 TGTTAGTCAAAGAGATTGGTGGG + Intergenic
1008072999 6:47116667-47116689 AGTGGGGCATAGGGCTGGGTAGG + Intergenic
1008979175 6:57463739-57463761 TGTGAGGAATATAGCTTGCGTGG - Intronic
1009167311 6:60356731-60356753 TGTGAGGAATATAGCTTGCGTGG - Intergenic
1011267882 6:85543416-85543438 TGTCAGAACTAGAGCTTGGTTGG - Intronic
1015971078 6:138742975-138742997 AAAGAGGCACAGAGCTTGGTGGG + Intergenic
1016838720 6:148505063-148505085 TGTGAAGTCTAGAGCTTGGCAGG - Intronic
1017000747 6:149995652-149995674 TGGGAGGGGCAGAGCTTGGTGGG - Intergenic
1021233277 7:18111132-18111154 TGTGAAGCTTACAGCTTAGTGGG + Intronic
1021483948 7:21146833-21146855 TGGGAGGGTTTGAGCTTGGTGGG + Intergenic
1021596724 7:22325122-22325144 TGGGAGGCTCAGGGCTTGGTTGG - Intronic
1021973324 7:25986019-25986041 TATGAGGCAAAGAACTTGGAGGG - Intergenic
1022533825 7:31083629-31083651 TGTGAGGCTTAGAGCTCTGAGGG + Intronic
1023866747 7:44242027-44242049 TGTGAGGCCTGGGGCTTGGAAGG - Intronic
1024282806 7:47733389-47733411 TTTGAGCCTTAGAGCTAGGTTGG + Intronic
1026827790 7:73595174-73595196 TGAGAGGCAGAGAGCTGGGAAGG - Intronic
1029544666 7:101204047-101204069 TGTGAGACACAGAGCAAGGTAGG + Intergenic
1031851334 7:126868025-126868047 GGTAAGACATAGAGCTTGGCTGG + Intronic
1037678730 8:21074957-21074979 GGTGGGGCAGAGATCTTGGTAGG - Intergenic
1037748224 8:21663029-21663051 TGTGGGGCAGGCAGCTTGGTAGG - Intergenic
1038652748 8:29420638-29420660 TGGGAGGCATATAGCTCTGTGGG + Intergenic
1043021264 8:75002806-75002828 CGTGAGACATAGAACTTGGCAGG + Intronic
1047007116 8:120631861-120631883 TGTGAGGCACAGTGCTAGGCAGG - Intronic
1048208974 8:132439094-132439116 GGTTCGGCATAAAGCTTGGTAGG - Intronic
1050225068 9:3444406-3444428 AGGGAGGGATAGATCTTGGTGGG + Intronic
1061004536 9:127921134-127921156 TGTGAAGCCAAGACCTTGGTCGG + Exonic
1061167561 9:128932779-128932801 TGTGAGCCACAGTGCCTGGTTGG + Intronic
1189101533 X:38195484-38195506 TTTGATGCAAAGAGCTTGTTAGG + Intronic
1190812730 X:53900419-53900441 AATGAGGCACAGTGCTTGGTGGG + Intergenic
1194860840 X:98997548-98997570 TTTGAGGCTTAGAGCTTAGATGG + Intergenic
1198594607 X:138222841-138222863 TGTGAGGGATATAGCTTTGTGGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201464430 Y:14264914-14264936 AGACAGGCATAGAGCTTGGGGGG - Intergenic